Free Full Text Journal Articles: Pharmacology -- Neurotransmitter.net

Recent Articles in PLoS Medicine / Public Libary of Science

Souza R, Yasuda S, Cristofani S
Treating schizophrenia with DOTS in developing countries: one size does not fit all.
PLoS Med. 2007 Sep 25;4(9):e281; author reply e285. [Abstract/Link to Full Text]

Patel V, Farooq S, Thara R
What is the best approach to treating schizophrenia in developing countries?
PLoS Med. 2007 Jun;4(6):e159.
BACKGROUND TO THE DEBATE: Schizophrenia affects an estimated 25 million people in low- and middle-income countries, with an average lifetime risk of about 1%. The illness is associated with excess mortality from a variety of causes. A 2001 Institute of Medicine report on mental illness in developing countries found that in 1990, over two-thirds of people with schizophrenia in these countries were not receiving any treatment (http://www.nap.edu/catalog/10111.html). The report found no evidence that the proportion of treated people in the developing world had increased since 1990. There is now a debate among mental health professionals in low-income countries over how best to improve patient care. In this article, three psychiatrists give their different viewpoints on the current status of treatment efforts for schizophrenia in the developing world and the measures that can be taken to increase the proportion of patients receiving treatment. [Abstract/Link to Full Text]

Kasi PM, Kassi M, Khawar T
Excessive work hours of physicians in training: maladaptive coping strategies.
PLoS Med. 2007 Sep 25;4(9):e279. [Abstract/Link to Full Text]

Fern�ndez Taylor KR
Excessive work hours of physicians in training in El Salvador: putting patients at risk.
PLoS Med. 2007 Jul;4(7):e205. [Abstract/Link to Full Text]

Braun L, Fausto-Sterling A, Fullwiley D, Hammonds EM, Nelson A, Quivers W, Reverby SM, Shields AE
Racial categories in medical practice: how useful are they?
PLoS Med. 2007 Sep 25;4(9):e271. [Abstract/Link to Full Text]

Ellison GT, Smart A, Tutton R, Outram SM, Ashcroft R, Martin P
Racial categories in medicine: a failure of evidence-based practice?
PLoS Med. 2007 Sep 25;4(9):e287. [Abstract/Link to Full Text]

Kurreeman FA, Padyukov L, Marques RB, Schrodi SJ, Seddighzadeh M, Stoeken-Rijsbergen G, van der Helm-van Mil AH, Allaart CF, Verduyn W, Houwing-Duistermaat J, Alfredsson L, Begovich AB, Klareskog L, Huizinga TW, Toes RE
A candidate gene approach identifies the TRAF1/C5 region as a risk factor for rheumatoid arthritis.
PLoS Med. 2007 Sep 18;4(9):e278.
BACKGROUND: Rheumatoid arthritis (RA) is a chronic autoimmune disorder affecting approximately 1% of the population. The disease results from the interplay between an individual's genetic background and unknown environmental triggers. Although human leukocyte antigens (HLAs) account for approximately 30% of the heritable risk, the identities of non-HLA genes explaining the remainder of the genetic component are largely unknown. Based on functional data in mice, we hypothesized that the immune-related genes complement component 5 (C5) and/or TNF receptor-associated factor 1 (TRAF1), located on Chromosome 9q33-34, would represent relevant candidate genes for RA. We therefore aimed to investigate whether this locus would play a role in RA. METHODS AND FINDINGS: We performed a multitiered case-control study using 40 single-nucleotide polymorphisms (SNPs) from the TRAF1 and C5 (TRAF1/C5) region in a set of 290 RA patients and 254 unaffected participants (controls) of Dutch origin. Stepwise replication of significant SNPs was performed in three independent sample sets from the Netherlands (ncases/controls = 454/270), Sweden (ncases/controls = 1,500/1,000) and US (ncases/controls = 475/475). We observed a significant association (p < 0.05) of SNPs located in a haplotype block that encompasses a 65 kb region including the 3' end of C5 as well as TRAF1. A sliding window analysis revealed an association peak at an intergenic region located approximately 10 kb from both C5 and TRAF1. This peak, defined by SNP14/rs10818488, was confirmed in a total of 2,719 RA patients and 1,999 controls (odds ratiocommon = 1.28, 95% confidence interval 1.17-1.39, pcombined = 1.40 x 10(-8)) with a population-attributable risk of 6.1%. The A (minor susceptibility) allele of this SNP also significantly correlates with increased disease progression as determined by radiographic damage over time in RA patients (p = 0.008). CONCLUSIONS: Using a candidate-gene approach we have identified a novel genetic risk factor for RA. Our findings indicate that a polymorphism in the TRAF1/C5 region increases the susceptibility to and severity of RA, possibly by influencing the structure, function, and/or expression levels of TRAF1 and/or C5. [Abstract/Link to Full Text]

Dworkin SL, Santelli J
Do abstinence-plus interventions reduce sexual risk behavior among youth?
PLoS Med. 2007 Sep 18;4(9):e276. [Abstract/Link to Full Text]

Underhill K, Operario D, Montgomery P
Systematic review of abstinence-plus HIV prevention programs in high-income countries.
PLoS Med. 2007 Sep 18;4(9):e275.
BACKGROUND: Abstinence-plus (comprehensive) interventions promote sexual abstinence as the best means of preventing HIV, but also encourage condom use and other safer-sex practices. Some critics of abstinence-plus programs have suggested that promoting safer sex along with abstinence may undermine abstinence messages or confuse program participants; conversely, others have suggested that promoting abstinence might undermine safer-sex messages. We conducted a systematic review to investigate the effectiveness of abstinence-plus interventions for HIV prevention among any participants in high-income countries as defined by the World Bank. METHODS AND FINDINGS: Cochrane Collaboration systematic review methods were used. We included randomized and quasi-randomized controlled trials of abstinence-plus programs for HIV prevention among any participants in any high-income country; trials were included if they reported behavioural or biological outcomes. We searched 30 electronic databases without linguistic or geographical restrictions to February 2007, in addition to contacting experts, hand-searching conference abstracts, and cross-referencing papers. After screening 20,070 abstracts and 325 full published and unpublished papers, we included 39 trials that included approximately 37,724 North American youth. Programs were based in schools (10), community facilities (24), both schools and community facilities (2), health care facilities (2), and family homes (1). Control groups varied. All outcomes were self-reported. Quantitative synthesis was not possible because of heterogeneity across trials in programs and evaluation designs. Results suggested that many abstinence-plus programs can reduce HIV risk as indicated by self-reported sexual behaviours. Of 39 trials, 23 found a protective program effect on at least one sexual behaviour, including abstinence, condom use, and unprotected sex (baseline n = 19,819). No trial found adverse program effects on any behavioural outcome, including incidence of sex, frequency of sex, sexual initiation, or condom use. This suggests that abstinence-plus approaches do not undermine program messages encouraging abstinence, nor do they undermine program messages encouraging safer sex. Findings consistently favoured abstinence-plus programs over controls for HIV knowledge outcomes, suggesting that abstinence-plus programs do not confuse participants. Results for biological outcomes were limited by floor effects. Three trials assessed self-reported diagnosis or treatment of sexually transmitted infection; none found significant effects. Limited evidence from seven evaluations suggested that some abstinence-plus programs can reduce pregnancy incidence. No trial observed an adverse biological program effect. CONCLUSIONS: Many abstinence-plus programs appear to reduce short-term and long-term HIV risk behaviour among youth in high-income countries. Programs did not cause harm. Although generalisability may be somewhat limited to North American adolescents, these findings have critical implications for abstinence-based HIV prevention policies. Suggestions are provided for improving the conduct and reporting of trials of abstinence-plus and other behavioural interventions to prevent HIV. [Abstract/Link to Full Text]

Gernburd P, Jadad AR
Will spam overwhelm our defenses? Evaluating offerings for drugs and natural health products.
PLoS Med. 2007 Sep 18;4(9):e274. [Abstract/Link to Full Text]

Tindana PO, Singh JA, Tracy CS, Upshur RE, Daar AS, Singer PA, Frohlich J, Lavery JV
Grand challenges in global health: community engagement in research in developing countries.
PLoS Med. 2007 Sep 11;4(9):e273. [Abstract/Link to Full Text]

Bhan A, Singh JA, Upshur RE, Singer PA, Daar AS
Grand challenges in global health: engaging civil society organizations in biomedical research in developing countries.
PLoS Med. 2007 Sep 11;4(9):e272. [Abstract/Link to Full Text]

Berndtson K, Daid T, Tracy CS, Bhan A, Cohen ER, Upshur RE, Singh JA, Daar AS, Lavery JV, Singer PA
Grand challenges in global health: ethical, social, and cultural issues based on key informant perspectives.
PLoS Med. 2007 Sep 11;4(9):e268. [Abstract/Link to Full Text]

Singer PA, Taylor AD, Daar AS, Upshur RE, Singh JA, Lavery JV
Grand challenges in global health: the ethical, social and cultural program.
PLoS Med. 2007 Sep 11;4(9):e265. [Abstract/Link to Full Text]

Di Angelantonio E, Danesh J, Eiriksdottir G, Gudnason V
Renal function and risk of coronary heart disease in general populations: new prospective study and systematic review.
PLoS Med. 2007 Sep 4;4(9):e270.
BACKGROUND: End-stage chronic kidney disease is associated with striking excesses of cardiovascular mortality, but it is uncertain to what extent renal function is related to risk of subsequent coronary heart disease (CHD) in apparently healthy adults. This study aims to quantify the association of markers of renal function with CHD risk in essentially general populations. METHODS AND FINDINGS: Estimated glomerular filtration rate (eGFR) was calculated using standard prediction equations based on serum creatinine measurements made in 2,007 patients diagnosed with nonfatal myocardial infarction or coronary death during follow-up and in 3,869 people without CHD in the Reykjavik population-based cohort of 18,569 individuals. There were small and nonsignificant odds ratios (ORs) for CHD risk over most of the range in eGFR, except in the lowest category of the lowest fifth (corresponding to values of <60 ml/min/1.73 m2), in which the OR was 1.33 (95% confidence interval 1.01-1.75) after adjustment for several established cardiovascular risk factors. Findings from the Reykjavik study were reinforced by a meta-analysis of six previous reports (identified in electronic and other databases) involving a total of 4,720 incident CHD cases (including Reykjavik), which yielded a combined risk ratio of 1.41 (95% confidence interval 1.19-1.68) in individuals with baseline eGFR less than 60 ml/min/1.73 m2 compared with those with higher values. CONCLUSIONS: Although there are no strong associations between lower-than-average eGFR and CHD risk in apparently healthy adults over most of the range in renal function, there may be a moderate increase in CHD risk associated with very low eGFR (i.e., renal dysfunction) in the general population. These findings could have implications for the further understanding of CHD and targeting cardioprotective interventions. [Abstract/Link to Full Text]

Mei SH, McCarter SD, Deng Y, Parker CH, Liles WC, Stewart DJ
Prevention of LPS-induced acute lung injury in mice by mesenchymal stem cells overexpressing angiopoietin 1.
PLoS Med. 2007 Sep 4;4(9):e269.
BACKGROUND: The acute respiratory distress syndrome (ARDS), a clinical complication of severe acute lung injury (ALI) in humans, is a leading cause of morbidity and mortality in critically ill patients. ALI is characterized by disruption of the lung alveolar-capillary membrane barrier and resultant pulmonary edema associated with a proteinaceous alveolar exudate. Current specific treatment strategies for ALI/ARDS are lacking. We hypothesized that mesenchymal stem cells (MSCs), with or without transfection with the vasculoprotective gene angiopoietin 1 (ANGPT1) would have beneficial effects in experimental ALI in mice. METHODS AND FINDINGS: Syngeneic MSCs with or without transfection with plasmid containing the human ANGPT1 gene (pANGPT1) were delivered through the right jugular vein of mice 30 min after intratracheal instillation of lipopolysaccharide (LPS) to induce lung injury. Administration of MSCs significantly reduced LPS-induced pulmonary inflammation, as reflected by reductions in total cell and neutrophil counts in bronchoalveolar lavage (BAL) fluid (53%, 95% confidence interval [CI] 7%-101%; and 60%, CI 4%-116%, respectively) as well as reducing levels of proinflammatory cytokines in both BAL fluid and lung parenchymal homogenates. Furthermore, administration of MSCs transfected with pANGPT1 resulted in nearly complete reversal of LPS-induced increases in lung permeability as assessed by reductions in IgM and albumin levels in BAL (96%, CI 6%-185%; and 74%, CI 23%-126%, respectively). Fluorescently tagged MSCs were detected in the lung tissues by confocal microscopy and flow cytometry in both na�ve and LPS-injured animals up to 3 d. CONCLUSIONS: Treatment with MSCs alone significantly reduced LPS-induced acute pulmonary inflammation in mice, while administration of pANGPT1-transfected MSCs resulted in a further improvement in both alveolar inflammation and permeability. These results suggest a potential role for cell-based ANGPT1 gene therapy to treat clinical ALI/ARDS. [Abstract/Link to Full Text]

Aarabi S, Longaker MT, Gurtner GC
Hypertrophic scar formation following burns and trauma: new approaches to treatment.
PLoS Med. 2007 Sep 4;4(9):e234. [Abstract/Link to Full Text]

Lawlor DA, Fraser A, Ebrahim S, Smith GD
Independent associations of fasting insulin, glucose, and glycated haemoglobin with stroke and coronary heart disease in older women.
PLoS Med. 2007 Aug 28;4(8):e263.
BACKGROUND: Evidence suggests that variations in fasting glucose and insulin amongst those without frank type 2 diabetes mellitus are important determinants of cardiovascular disease. However, the relative importance of variations in fasting insulin, glucose, and glycated haemoglobin as risk factors for cardiovascular disease in women without diabetes is unclear. Our aim was to determine the independent associations of fasting insulin, glucose, and glycated haemoglobin with coronary heart disease and stroke in older women. METHODS AND FINDINGS: We undertook a prospective cohort study of 3,246 British women aged 60-79 y, all of whom were free of baseline coronary heart disease, stroke, and diabetes, and all of whom had fasting glucose levels below 7 mmol/l. Fasting insulin and homeostasis model assessment for insulin sensitivity (HOMA-S) were linearly associated with a combined outcome of coronary heart disease or stroke (n = 219 events), but there was no association of fasting glucose or glycated haemoglobin with these outcomes. Results were similar for coronary heart disease and stroke as separate outcomes. The age, life-course socioeconomic position, smoking, and physical activity adjusted hazard ratio for a combined outcome of incident coronary heart disease or stroke per one standard deviation of fasting insulin was 1.14 (95% CI 1.02-1.33). Additional adjustment for other components of metabolic syndrome, low-density lipoprotein cholesterol, fasting glucose, and glycated haemoglobin had little effect on this result. CONCLUSIONS: Our findings suggest that in women in the 60-79 y age range, insulin resistance, rather than insulin secretion or chronic hyperglycaemia, is a more important risk factor for coronary heart disease and stroke. Below currently used thresholds of fasting glucose for defining diabetes, neither fasting glucose nor glycated haemoglobin are associated with cardiovascular disease. [Abstract/Link to Full Text]

Hemming ML, Patterson M, Reske-Nielsen C, Lin L, Isacson O, Selkoe DJ
Reducing amyloid plaque burden via ex vivo gene delivery of an Abeta-degrading protease: a novel therapeutic approach to Alzheimer disease.
PLoS Med. 2007 Aug 28;4(8):e262.
BACKGROUND: Understanding the mechanisms of amyloid-beta protein (Abeta) production and clearance in the brain has been essential to elucidating the etiology of Alzheimer disease (AD). Chronically decreasing brain Abeta levels is an emerging therapeutic approach for AD, but no such disease-modifying agents have achieved clinical validation. Certain proteases are responsible for the catabolism of brain Abeta in vivo, and some experimental evidence suggests they could be used as therapeutic tools to reduce Abeta levels in AD. The objective of this study was to determine if enhancing the clearance of Abeta in the brain by ex vivo gene delivery of an Abeta-degrading protease can reduce amyloid plaque burden. METHODS AND FINDINGS: We generated a secreted form of the Abeta-degrading protease neprilysin, which significantly lowers the levels of naturally secreted Abeta in cell culture. We then used an ex vivo gene delivery approach utilizing primary fibroblasts to introduce this soluble protease into the brains of beta-amyloid precursor protein (APP) transgenic mice with advanced plaque deposition. Brain examination after cell implantation revealed robust clearance of plaques at the site of engraftment (72% reduction, p = 0.0269), as well as significant reductions in plaque burden in both the medial and lateral hippocampus distal to the implantation site (34% reduction, p = 0.0020; and 55% reduction, p = 0.0081, respectively). CONCLUSIONS: Ex vivo gene delivery of an Abeta-degrading protease reduces amyloid plaque burden in transgenic mice expressing human APP. These results support the use of Abeta-degrading proteases as a means to therapeutically lower Abeta levels and encourage further exploration of ex vivo gene delivery for the treatment of Alzheimer disease. [Abstract/Link to Full Text]

de Munter JS, Hu FB, Spiegelman D, Franz M, van Dam RM
Whole grain, bran, and germ intake and risk of type 2 diabetes: a prospective cohort study and systematic review.
PLoS Med. 2007 Aug 28;4(8):e261.
BACKGROUND: Control of body weight by balancing energy intake and energy expenditure is of major importance for the prevention of type 2 diabetes, but the role of specific dietary factors in the etiology of type 2 diabetes is less well established. We evaluated intakes of whole grain, bran, and germ in relation to risk of type 2 diabetes in prospective cohort studies. METHODS AND FINDINGS: We followed 161,737 US women of the Nurses' Health Studies (NHSs) I and II, without history of diabetes, cardiovascular disease, or cancer at baseline. The age at baseline was 37-65 y for NHSI and 26-46 y for NHSII. Dietary intakes and potential confounders were assessed with regularly administered questionnaires. We documented 6,486 cases of type 2 diabetes during 12-18 y of follow-up. Other prospective cohort studies on whole grain intake and risk of type 2 diabetes were identified in searches of MEDLINE and EMBASE up to January 2007, and data were independently extracted by two reviewers. The median whole grain intake in the lowest and highest quintile of intake was, respectively, 3.7 and 31.2 g/d for NHSI and 6.2 and 39.9 g/d for NHSII. After adjustment for potential confounders, the relative risks (RRs) for the highest as compared with the lowest quintile of whole grain intake was 0.63 (95% confidence interval [CI] 0.57-0.69) for NHSI and 0.68 (95% CI 0.57-0.81) for NHSII (both: p-value, test for trend <0.001). After further adjustment for body mass index (BMI), these RRs were 0.75 (95% CI 0.68-0.83; p-value, test for trend <0.001) and 0.86 (95% CI 0.72-1.02; p-value, test for trend 0.03) respectively. Associations for bran intake were similar to those for total whole grain intake, whereas no significant association was observed for germ intake after adjustment for bran. Based on pooled data for six cohort studies including 286,125 participants and 10,944 cases of type 2 diabetes, a two-serving-per-day increment in whole grain consumption was associated with a 21% (95% CI 13%-28%) decrease in risk of type 2 diabetes after adjustment for potential confounders and BMI. CONCLUSIONS: Whole grain intake is inversely associated with risk of type 2 diabetes, and this association is stronger for bran than for germ. Findings from prospective cohort studies consistently support increasing whole grain consumption for the prevention of type 2 diabetes. [Abstract/Link to Full Text]

Tomlinson M, Chopra M, Sanders D, Bradshaw D, Hendricks M, Greenfield D, Black RE, El Arifeen S, Rudan I
Setting priorities in child health research investments for South Africa.
PLoS Med. 2007 Aug 28;4(8):e259. [Abstract/Link to Full Text]

Qualitative research: understanding patients' needs and experiences.
PLoS Med. 2007 Aug 28;4(8):e258. [Abstract/Link to Full Text]

Anstey NM, Price RN
Improving case definitions for severe malaria.
PLoS Med. 2007 Aug 21;4(8):e267. [Abstract/Link to Full Text]

Bejon P, Berkley JA, Mwangi T, Ogada E, Mwangi I, Maitland K, Williams T, Scott JA, English M, Lowe BS, Peshu N, Newton CR, Marsh K
Defining childhood severe falciparum malaria for intervention studies.
PLoS Med. 2007 Aug 21;4(8):e251.
BACKGROUND: Clinical trials of interventions designed to prevent severe falciparum malaria in children require a clear endpoint. The internationally accepted definition of severe malaria is sensitive, and appropriate for clinical purposes. However, this definition includes individuals with severe nonmalarial disease and coincident parasitaemia, so may lack specificity in vaccine trials. Although there is no "gold standard" individual test for severe malaria, malaria-attributable fractions (MAFs) can be estimated among groups of children using a logistic model, which we use to test the suitability of various case definitions as trial endpoints. METHODS AND FINDINGS: A total of 4,583 blood samples were taken from well children in cross-sectional surveys and from 1,361 children admitted to a Kenyan District hospital with severe disease. Among children under 2 y old with severe disease and over 2,500 parasites per microliter of blood, the MAFs were above 85% in moderate- and low-transmission areas, but only 61% in a high-transmission area. HIV and malnutrition were not associated with reduced MAFs, but gastroenteritis with severe dehydration (defined by reduced skin turgor), lower respiratory tract infection (clinician's final diagnosis), meningitis (on cerebrospinal fluid [CSF] examination), and bacteraemia were associated with reduced MAFs. The overall MAF was 85% (95% confidence interval [CI] 83.8%-86.1%) without excluding these conditions, 89% (95% CI 88.4%-90.2%) after exclusions, and 95% (95% CI 94.0%-95.5%) when a threshold of 2,500 parasites/mul was also applied. Applying a threshold and exclusion criteria reduced sensitivity to 80% (95% CI 77%-83%). CONCLUSIONS: The specificity of a case definition for severe malaria is improved by applying a parasite density threshold and by excluding children with meningitis, lower respiratory tract infection (clinician's diagnosis), bacteraemia, and gastroenteritis with severe dehydration, but not by excluding children with HIV or malnutrition. [Abstract/Link to Full Text]

Tonwe-Gold B, Ekouevi DK, Viho I, Amani-Bosse C, Toure S, Coffie PA, Rouet F, Becquet R, Leroy V, El-Sadr WM, Abrams EJ, Dabis F
Antiretroviral treatment and prevention of peripartum and postnatal HIV transmission in West Africa: evaluation of a two-tiered approach.
PLoS Med. 2007 Aug 21;4(8):e257.
BACKGROUND: Highly active antiretroviral treatment (HAART) has only been recently recommended for HIV-infected pregnant women requiring treatment for their own health in resource-limited settings. However, there are few documented experiences from African countries. We evaluated the short-term (4 wk) and long-term (12 mo) effectiveness of a two-tiered strategy of prevention of mother-to-child transmission of HIV (PMTCT) in Africa: women meeting the eligibility criteria of the World Health Organization (WHO) received HAART, and women with less advanced HIV disease received short-course antiretroviral (scARV) PMTCT regimens. METHODS AND FINDINGS: The MTCT-Plus Initiative is a multi-country, family-centred HIV care and treatment program for pregnant and postpartum women and their families. Pregnant women enrolled in Abidjan, C�te d'Ivoire received either HAART for their own health or short-course antiretroviral (scARV) PMTCT regimens according to their clinical and immunological status. Plasma HIV-RNA viral load (VL) was measured to diagnose peripartum infection when infants were 4 wk of age, and HIV final status was documented either by rapid antibody testing when infants were aged > or = 12 mo or by plasma VL earlier. The Kaplan-Meier method was used to estimate the rate of HIV transmission and HIV-free survival. Between August 2003 and June 2005, 107 women began HAART at a median of 30 wk of gestation, 102 of them with zidovudine (ZDV), lamivudine (3TC), and nevirapine (NVP) and they continued treatment postpartum; 143 other women received scARV for PMTCT, 103 of them with sc(ZDV+3TC) with single-dose NVP during labour. Most (75%) of the infants were breast-fed for a median of 5 mo. Overall, the rate of peripartum HIV transmission was 2.2% (95% confidence interval [CI] 0.3%-4.2%) and the cumulative rate at 12 mo was 5.7% (95% CI 2.5%-9.0%). The overall probability of infant death or infection with HIV was 4.3% (95% CI 1.7%-7.0%) at age week 4 wk and 11.7% (95% CI 7.5%-15.9%) at 12 mo. CONCLUSIONS: This two-tiered strategy appears to be safe and highly effective for short- and long-term PMTCT in resource-constrained settings. These results indicate a further benefit of access to HAART for pregnant women who need treatment for their own health. [Abstract/Link to Full Text]

Smith TC, Novella SP
HIV denial in the Internet era.
PLoS Med. 2007 Aug 21;4(8):e256. [Abstract/Link to Full Text]

Noor AM, Amin AA, Akhwale WS, Snow RW
Increasing coverage and decreasing inequity in insecticide-treated bed net use among rural Kenyan children.
PLoS Med. 2007 Aug 21;4(8):e255.
BACKGROUND: Inexpensive and efficacious interventions that avert childhood deaths in sub-Saharan Africa have failed to reach effective coverage, especially among the poorest rural sectors. One particular example is insecticide-treated bed nets (ITNs). In this study, we present repeat observations of ITN coverage among rural Kenyan homesteads exposed at different times to a range of delivery models, and assess changes in coverage across socioeconomic groups. METHODS AND FINDINGS: We undertook a study of annual changes in ITN coverage among a cohort of 3,700 children aged 0-4 y in four districts of Kenya (Bondo, Greater Kisii, Kwale, and Makueni) annually between 2004 and 2006. Cross-sectional surveys of ITN coverage were undertaken coincidentally with the incremental availability of commercial sector nets (2004), the introduction of heavily subsidized nets through clinics (2005), and the introduction of free mass distributed ITNs (2006). The changing prevalence of ITN coverage was examined with special reference to the degree of equity in each delivery approach. ITN coverage was only 7.1% in 2004 when the predominant source of nets was the commercial retail sector. By the end of 2005, following the expansion of heavily subsidized clinic distribution system, ITN coverage rose to 23.5%. In 2006 a large-scale mass distribution of ITNs was mounted providing nets free of charge to children, resulting in a dramatic increase in ITN coverage to 67.3%. With each subsequent survey socioeconomic inequity in net coverage sequentially decreased: 2004 (most poor [2.9%] versus least poor [15.6%]; concentration index 0.281); 2005 (most poor [17.5%] versus least poor [37.9%]; concentration index 0.131), and 2006 with near-perfect equality (most poor [66.3%] versus least poor [66.6%]; concentration index 0.000). The free mass distribution method achieved highest coverage among the poorest children, the highly subsidised clinic nets programme was marginally in favour of the least poor, and the commercial social marketing favoured the least poor. CONCLUSIONS: Rapid scaling up of ITN coverage among Africa's poorest rural children can be achieved through mass distribution campaigns. These efforts must form an important adjunct to regular, routine access to ITNs through clinics, and each complimentary approach should aim to make this intervention free to clients to ensure equitable access among those least able to afford even the cost of a heavily subsidized net. [Abstract/Link to Full Text]

Low-Beer D, Afkhami H, Komatsu R, Banati P, Sempala M, Katz I, Cutler J, Schumacher P, Tran-Ba-Huy R, Schwartl�nder B
Making performance-based funding work for health.
PLoS Med. 2007 Aug 21;4(8):e219. [Abstract/Link to Full Text]

Senechal B, Elain G, Jeziorski E, Grondin V, Patey-Mariaud de Serre N, Jaubert F, Beldjord K, Lellouch A, Glorion C, Zerah M, Mary P, Barkaoui M, Emile JF, Boccon-Gibod L, Josset P, Debr� M, Fischer A, Donadieu J, Geissmann F
Expansion of regulatory T cells in patients with Langerhans cell histiocytosis.
PLoS Med. 2007 Aug 14;4(8):e253.
BACKGROUND: Langerhans cell histiocytosis (LCH) is a rare clonal granulomatous disease that affects mainly children. LCH can involve various tissues such as bone, skin, lung, bone marrow, lymph nodes, and the central nervous system, and is frequently responsible for functional sequelae. The pathophysiology of LCH is unclear, but the uncontrolled proliferation of Langerhans cells (LCs) is believed to be the primary event in the formation of granulomas. The present study was designed to further investigate the nature of proliferating cells and the immune mechanisms involved in the LCH granulomas. METHODS AND FINDINGS: Biopsies (n = 24) and/or blood samples (n = 25) from 40 patients aged 0.25 to 13 y (mean 7.8 y), were studied to identify cells that proliferate in blood and granulomas. We found that the proliferating index of LCs was low ( approximately 1.9%), and we did not observe expansion of a monocyte or dendritic cell compartment in patients. We found that LCH lesions were a site of active inflammation, tissue remodeling, and neo-angiogenesis, and the majority of proliferating cells were endothelial cells, fibroblasts, and polyclonal T lymphocytes. Within granulomas, interleukin 10 was abundant, LCs expressed the TNF receptor family member RANK, and CD4(+) CD25(high) FoxP3(high) regulatory T cells (T-regs) represented 20% of T cells, and were found in close contact with LCs. FoxP3(+) T-regs were also expanded compared to controls, in the blood of LCH patients with active disease, among whom seven out of seven tested exhibited an impaired skin delayed-type hypersensitivity response. In contrast, the number of blood T-regs were normal after remission of LCH. CONCLUSIONS: These findings indicate that LC accumulation in LCH results from survival rather than uncontrolled proliferation, and is associated with the expansion of T-regs. These data suggest that LCs may be involved in the expansion of T-regs in vivo, resulting in the failure of the host immune system to eliminate LCH cells. Thus T-regs could be a therapeutic target in LCH. [Abstract/Link to Full Text]

Bates I, McKew S, Sarkinfada F
Anaemia: a useful indicator of neglected disease burden and control.
PLoS Med. 2007 Aug 14;4(8):e231. [Abstract/Link to Full Text]

Swen JJ, Huizinga TW, Gelderblom H, de Vries EG, Assendelft WJ, Kirchheiner J, Guchelaar HJ
Translating pharmacogenomics: challenges on the road to the clinic.
PLoS Med. 2007 Aug 14;4(8):e209.
Pharmacogenomics is one of the first clinical applications of the postgenomic era. It promises personalized medicine rather than the established "one size fits all" approach to drugs and dosages. The expected reduction in trial and error should ultimately lead to more efficient and safer drug therapy. In recent years, commercially available pharmacogenomic tests have been approved by the Food and Drug Administration (FDA), but their application in patient care remains very limited. More generally, the implementation of pharmacogenomics in routine clinical practice presents significant challenges. This article presents specific clinical examples of such challenges and discusses how obstacles to implementation of pharmacogenomic testing can be addressed. [Abstract/Link to Full Text]

Ramjee G, Govinden R, Morar NS, Mbewu A
South Africa's experience of the closure of the cellulose sulphate microbicide trial.
PLoS Med. 2007 Jul;4(7):e235. [Abstract/Link to Full Text]

Brennan MJ, Fruth U, Milstien J, Tiernan R, de Andrade Nishioka S, Chocarro L
Development of new tuberculosis vaccines: a global perspective on regulatory issues.
PLoS Med. 2007 Aug 7;4(8):e252. [Abstract/Link to Full Text]

McAlister FA, van Diepen S, Padwal RS, Johnson JA, Majumdar SR
How evidence-based are the recommendations in evidence-based guidelines?
PLoS Med. 2007 Aug 7;4(8):e250.
BACKGROUND: Treatment recommendations for the same condition from different guideline bodies often disagree, even when the same randomized controlled trial (RCT) evidence is cited. Guideline appraisal tools focus on methodology and quality of reporting, but not on the nature of the supporting evidence. This study was done to evaluate the quality of the evidence (based on consideration of its internal validity, clinical relevance, and applicability) underlying therapy recommendations in evidence-based clinical practice guidelines. METHODS AND FINDINGS: A cross-sectional analysis of cardiovascular risk management recommendations was performed for three different conditions (diabetes mellitus, dyslipidemia, and hypertension) from three pan-national guideline panels (from the United States, Canada, and Europe). Of the 338 treatment recommendations in these nine guidelines, 231 (68%) cited RCT evidence but only 105 (45%) of these RCT-based recommendations were based on high-quality evidence. RCT-based evidence was downgraded most often because of reservations about the applicability of the RCT to the populations specified in the guideline recommendation (64/126 cases, 51%) or because the RCT reported surrogate outcomes (59/126 cases, 47%). CONCLUSIONS: The results of internally valid RCTs may not be applicable to the populations, interventions, or outcomes specified in a guideline recommendation and therefore should not always be assumed to provide high-quality evidence for therapy recommendations. [Abstract/Link to Full Text]

Olson DR, Heffernan RT, Paladini M, Konty K, Weiss D, Mostashari F
Monitoring the impact of influenza by age: emergency department fever and respiratory complaint surveillance in New York City.
PLoS Med. 2007 Aug 7;4(8):e247.
BACKGROUND: The importance of understanding age when estimating the impact of influenza on hospitalizations and deaths has been well described, yet existing surveillance systems have not made adequate use of age-specific data. Monitoring influenza-related morbidity using electronic health data may provide timely and detailed insight into the age-specific course, impact and epidemiology of seasonal drift and reassortment epidemic viruses. The purpose of this study was to evaluate the use of emergency department (ED) chief complaint data for measuring influenza-attributable morbidity by age and by predominant circulating virus. METHODS AND FINDINGS: We analyzed electronically reported ED fever and respiratory chief complaint and viral surveillance data in New York City (NYC) during the 2001-2002 through 2005-2006 influenza seasons, and inferred dominant circulating viruses from national surveillance reports. We estimated influenza-attributable impact as observed visits in excess of a model-predicted baseline during influenza periods, and epidemic timing by threshold and cross correlation. We found excess fever and respiratory ED visits occurred predominantly among school-aged children (8.5 excess ED visits per 1,000 children aged 5-17 y) with little or no impact on adults during the early-2002 B/Victoria-lineage epidemic; increased fever and respiratory ED visits among children younger than 5 y during respiratory syncytial virus-predominant periods preceding epidemic influenza; and excess ED visits across all ages during the 2003-2004 (9.2 excess visits per 1,000 population) and 2004-2005 (5.2 excess visits per 1,000 population) A/H3N2 Fujian-lineage epidemics, with the relative impact shifted within and between seasons from younger to older ages. During each influenza epidemic period in the study, ED visits were increased among school-aged children, and each epidemic peaked among school-aged children before other impacted age groups. CONCLUSIONS: Influenza-related morbidity in NYC was highly age- and strain-specific. The impact of reemerging B/Victoria-lineage influenza was focused primarily on school-aged children born since the virus was last widespread in the US, while epidemic A/Fujian-lineage influenza affected all age groups, consistent with a novel antigenic variant. The correspondence between predominant circulating viruses and excess ED visits, hospitalizations, and deaths shows that excess fever and respiratory ED visits provide a reliable surrogate measure of incident influenza-attributable morbidity. The highly age-specific impact of influenza by subtype and strain suggests that greater age detail be incorporated into ongoing surveillance. Influenza morbidity surveillance using electronic data currently available in many jurisdictions can provide timely and representative information about the age-specific epidemiology of circulating influenza viruses. [Abstract/Link to Full Text]

Montori VM, Breslin M, Maleska M, Weymiller AJ
Creating a conversation: insights from the development of a decision aid.
PLoS Med. 2007 Aug 7;4(8):e233. [Abstract/Link to Full Text]

Recent Articles in BMC Medicine

Kasper S, Anghelescu IG, Szegedi A, Dienel A, Kieser M
Superior efficacy of St John's wort extract WS 5570 compared to placebo in patients with major depression: a randomized, double-blind, placebo-controlled, multi-center trial [ISRCTN77277298].
BMC Med. 2006;414.
BACKGROUND: The aim of the current study was to assess the antidepressant efficacy and safety of Hypericum perforatum (St. John's wort) extract WS 5570 at doses of 600 mg/day in a single dose and 1200 mg/day in two doses. METHODS: The participants in this double-blind, randomized, placebo-controlled, multi-center clinical trial were male and female adult out-patients with an episode of mild or moderate major depressive episode (single or recurrent episode, DSM-IV criteria). As specified by the relevant guideline, the study was preceded by a medication-free run-in phase. For the 6-week treatment, 332 patients were randomized: 123 to WS 5570 600 mg/day, 127 to WS 5570 1200 mg/day, and 82 to placebo. The primary outcome measure was the change in total score on the Hamilton Rating Scale for Depression (HAM-D, 17-item version) between baseline and endpoint. Additional measures included the number of responders, the number of patients in remission, and several other standard rating scales. Efficacy and safety were assessed after 2 and 6 weeks. The design included an interim analysis performed after randomization with the option of early termination. RESULTS: After 6 weeks of treatment, mean +/- standard deviation decreases in HAM-D total scores of 11.6 +/- 6.4, 10.8 +/- 7.3, and 6.0 +/- 8.1 points were observed for the WS 5570 600 mg/day, 1200 mg/day and placebo groups, respectively (endpoint analysis). Secondary measures of treatment efficacy also showed that both WS 5570 groups were statistically superior to placebo. Significantly more patients in the WS 5570 treatment groups than in the placebo group showed treatment response and remission. WS 5570 was consistently more effective than placebo in patients with either less severe or more severe baseline impairment. The number of patients who experienced remission was higher in the WS 5570 1200 mg/day group than the WS 5570 600 mg/day group. The incidence of adverse events was low in all groups. The adverse event profile was consistent with the known profile for Hypericum extract preparations. CONCLUSION: Hypericum perforatum extract WS 5570 at doses of 600 mg/day (once daily) and 1200 mg/day (600 mg twice daily) were found to be safe and more effective than placebo, with comparable efficacy of the WS 5570 groups for the treatment of mild to moderate major depression. [Abstract/Link to Full Text]

Wager E, Parkin EC, Tamber PS
Are reviewers suggested by authors as good as those chosen by editors? Results of a rater-blinded, retrospective study.
BMC Med. 2006;413.
BACKGROUND: BioMed Central (BMC) requires authors to suggest four reviewers when making a submission. Editors searching for reviewers use these suggestions as a source. The review process of the medical journals in the BMC series is open--authors and reviewers know each other's identity--although reviewers can make confidential comments to the editor. Reviews are published alongside accepted articles so readers may see the reviewers' names and recommendations.Our objective was to compare the performance of author-nominated reviewers (ANR) with that of editor-chosen reviewers (ECR) in terms of review quality and recommendations about submissions in an online-only medical journal. METHODS: Pairs of reviews from 100 consecutive submissions to medical journals in the BMC series (with one author-nominated and one editor-chosen reviewer and a final decision) were assessed by two raters, blinded to reviewer type, using a validated review quality instrument (RQI) which rates 7 items on 5-point Likert scales. The raters discussed their ratings after the first 20 pairs (keeping reviewer type masked) and resolved major discrepancies in scoring and interpretation to improve inter-rater reliability. Reviewers' recommendations were also compared. RESULTS: Reviewer source had no impact on review quality (mean RQI score (+/- SD) 2.24 +/- 0.55 for ANR, 2.34 +/- 0.54 for ECR) or tone (mean scores on additional question 2.72 ANR vs 2.82 ECR) (maximum score = 5 in both cases). However author-nominated reviewers were significantly more likely to recommend acceptance (47 vs 35) and less likely to recommend rejection (10 vs 23) than editor-chosen reviewers after initial review (p < 0.001). However, by the final review stage (i.e. after authors had responded to reviewer comments) ANR and ECR recommendations were similar (65 vs 66 accept, 10 vs 14 reject, p = 0.47). The number of reviewers unable to decide about acceptance was similar in both groups at both review stages. CONCLUSION: Author-nominated reviewers produced reviews of similar quality to editor-chosen reviewers but were more likely to recommend acceptance during the initial stages of peer review. [Abstract/Link to Full Text]

Lim E, Cornelissen J, Routledge T, Ali A, Kirtland S, Sharples L, Sheridan K, Bellm S, Munday H, Large S
Biological efficacy of low versus medium dose aspirin after coronary surgery: results from a randomized trial [NCT00262275].
BMC Med. 2006;412.
BACKGROUND: The beneficial effect of aspirin after coronary surgery is established; however, a recent study reported the inability of low doses (100 mg) to inhibit postoperative platelet function. We conducted a double-blind randomised trial to establish the efficacy of low dose aspirin and to compare it against medium dose aspirin. METHODS: Patients undergoing coronary surgery were invited to participate and consenting patients were randomised to 100 mg or 325 mg of aspirin daily for 5 days. Our primary outcome was the difference in platelet aggregation (day 5 - baseline) using 1 microg/ml of collagen. Secondary outcomes were differences in EC50 of collagen, ADP and epinephrine (assessed using the technique of Born). RESULTS: From September 2002 to April 2004, 72 patients were randomised; 3 patients discontinued, leaving 35 and 34 in the low and medium dose aspirin arms respectively. The mean aggregation (using 1.1 microg/ml of collagen) was reduced in both the medium and low dose aspirin arms by 37% and 36% respectively. The baseline adjusted difference (low - medium) was 6% (95% CI -3 to 14; p = 0.19). The directions of the results for the differences in EC50 (low - medium) were consistent for collagen, ADP and epinephrine at -0.07 (-0.53 to 0.40), -0.08 (-0.28 to 0.11) and -4.41 (-10.56 to 1.72) respectively, but none were statistically significant. CONCLUSION : Contrary to recent findings, low dose aspirin is effective and medium dose aspirin did not prove superior for inhibiting platelet aggregation after coronary surgery. [Abstract/Link to Full Text]

Lemyre B, Sherlock R, Hogan D, Gaboury I, Blanchard C, Moher D
How effective is tetracaine 4% gel, before a peripherally inserted central catheter, in reducing procedural pain in infants: a randomized double-blind placebo controlled trial [ISRCTN75884221].
BMC Med. 2006;411.
BACKGROUND: Procedural pain relief is sub-optimal in infants, especially small and vulnerable ones. Tetracaine gel 4% (Ametop, Smith-Nephew) provides pain relief in children and larger infants, but its efficacy in smaller infants and for peripherally inserted central catheters (PICC) remains uncertain. The objective of this trial was to assess the safety and efficacy of tetracaine gel on the pain response of very low birth weight (VLBW) infants during insertion of a PICC. METHODS: Medically stable infants greater than or equal to 24 weeks gestation, requiring a non-urgent PICC, were included. Following randomization and double blinding, 1.1 g of tetracaine or placebo was applied to the skin for 30 minutes. The PICC was inserted according to a standard protocol. Pain was assessed using the Premature Infant Pain Profile (PIPP). A 3-point change in the pain score was considered clinically significant, leading to a sample size of 54 infants, with 90% statistical power. Local skin reactions and immediate adverse cardiorespiratory events were noted. The primary outcome, PIPP score at 1 minute, was analysed using an independent Student's t-test. RESULTS: Fifty-four infants were included, 27 +/- 2 weeks gestation, 916 +/- 292 grams and 6.5 +/- 3.2 days of age. Baseline characteristics were similar between groups. The mean PIPP score in the first minute was 10.88 in the treatment group as compared to 11.74 in the placebo group (difference 0.86, 95% CI -1.86, 3.58). Median duration of crying in non-intubated infants was 181 seconds in the tetracaine group compared to 68 seconds in the placebo group (difference -78, 95% CI -539, 117). Local skin erythema was observed transiently in 4 infants (3 in the treatment and 1 in the placebo group). No serious harms were observed. CONCLUSION: Tetracaine 4% when applied for 30 minutes was not beneficial in decreasing procedural pain associated with a PICC in very small infants. [Abstract/Link to Full Text]

Baier RJ, Loggins J, Yanamandra K
IL-10, IL-6 and CD14 polymorphisms and sepsis outcome in ventilated very low birth weight infants.
BMC Med. 2006;410.
BACKGROUND: Genetic variation in the innate immune system of the host may play a role in determining the risk of developing infection, as well as outcome from infection. METHODS: Infectious complications were retrospectively determined in 293 (233 African-American (AA), 57 Caucasian and 3 Hispanic) mechanically ventilated very low birth weight (VLBW) infants (<1500 grams at birth) who were genotyped for the IL-6 -174 G/C, IL-10 -1082 G/A and CD14 -260 C/T single nucleotide polymorphisms (SNPs). RESULTS: The IL-6 -174C allele was associated with an increased incidence of late blood stream infection (BSI) in AA but not Caucasian infants. In AA infants with the C allele the incidence of late BSI was 20/29 (69%) compared to 94/204 (46%) in homozygous GG infants (RR 2.6, 95% CI: 1.1-6.0, p = 0.021). The IL-10 -1082A allele was associated with an increased incidence of late BSI. One or more episodes of late BSI developed in 14 (35%) of 40 infants with the GG genotype, 71 (49%) of 145 infants with the GA genotype and 63 (58%) of 108 infants with the AA genotype (p = 0.036). Infants with the A allele (AA or GA genotypes) had an incidence of late BSI that was 134/253 (53%) compared to 14/40 (35%) in homozygous GG infants (RR 2.1, 95% CI: 1.04-4.19, p = 0.035). The CD14 -260 C/T SNP did not alter the overall risk for BSI in ventilated VLBW infants. Multiple BSI episodes were more common in the TT genotype group (CC: 17%, CT: 11%, TT: 30%, p = 0.022). This effect was due to the strong effect of the TT genotype on the incidence of multiple BSI in AA infants (CC: 15%, CT: 11%, TT: 39%, p = 0.003). CONCLUSION: The IL-6 -174 G/C, IL-10 -1082 G/A and CD14 -260 C/T SNPs may alter risk for BSI in ventilated VLBW infants. [Abstract/Link to Full Text]

Wearden AJ, Riste L, Dowrick C, Chew-Graham C, Bentall RP, Morriss RK, Peters S, Dunn G, Richardson G, Lovell K, Powell P
Fatigue Intervention by Nurses Evaluation--the FINE Trial. A randomised controlled trial of nurse led self-help treatment for patients in primary care with chronic fatigue syndrome: study protocol. [ISRCTN74156610].
BMC Med. 2006;49.
BACKGROUND: Chronic fatigue syndrome, also known as ME (CFS/ME), is a condition characterised primarily by severe, disabling fatigue, of unknown origin, which has a poor prognosis and serious personal and economic consequences. Evidence for the effectiveness of any treatment for CFS/ME in primary care, where most patients are seen, is sparse. Recently, a brief, pragmatic treatment for CFS/ME, based on a physiological dysregulation model of the condition, was shown to be successful in improving fatigue and physical functioning in patients in secondary care. The treatment involves providing patients with a readily understandable explanation of their symptoms, from which flows the rationale for a graded rehabilitative plan, developed collaboratively with the therapist. The present trial will test the effectiveness and cost-effectiveness of pragmatic rehabilitation when delivered by specially trained general nurses in primary care. We selected a client-centred counselling intervention, called supportive listening, as a comparison treatment. Counselling has been shown to be as effective as cognitive behaviour therapy for treating fatigue in primary care, is more readily available, and controls for supportive therapist contact time. Our control condition is treatment as usual by the general practitioner (GP). METHODS AND DESIGN: This study protocol describes the design of an ongoing, single-blind, pragmatic randomized controlled trial of a brief (18 week) self-help treatment, pragmatic rehabilitation, delivered by specially trained nurse-therapists in patients' homes, compared with nurse-therapist delivered supportive listening and treatment as usual by the GP. An economic evaluation, taking a societal viewpoint, is being carried out alongside the clinical trial. Three adult general nurses were trained over a six month period to deliver the two interventions. Patients aged over 18 and fulfilling the Oxford criteria for CFS are assessed at baseline, after the intervention, and again one year later. Primary outcomes are self-reported physical functioning and fatigue at one year, and will be analysed on an intention-to-treat basis. A qualitative study will examine the interventions' mechanisms of change, and also GPs' drivers and barriers towards referral. [Abstract/Link to Full Text]

Kari K, Liu W, Gautama K, Mammen MP, Clemens JD, Nisalak A, Subrata K, Kim HK, Xu ZY
A hospital-based surveillance for Japanese encephalitis in Bali, Indonesia.
BMC Med. 2006;48.
BACKGROUND: Japanese encephalitis (JE) is presumed to be endemic throughout Asia, yet only a few cases have been reported in tropical Asian countries such as Indonesia, Malaysia and the Philippines. To estimate the true disease burden due to JE in this region, we conducted a prospective, hospital-based surveillance with a catchment population of 599,120 children less than 12 years of age in Bali, Indonesia, from July 2001 through December 2003. METHODS: Balinese children presenting to any health care facility with acute viral encephalitis or aseptic meningitis were enrolled. A "confirmed" diagnosis of JE required the detection of JE virus (JEV)-specific IgM in cerebrospinal fluid, whereas a diagnosis of "probable JE" was assigned to those cases in which JEV-specific IgM was detected only in serum. RESULTS: In all, 86 confirmed and 4 probable JE cases were identified. The annualized JE incidence rate was 7.1 and adjusted to 8.2 per 100,000 for children less than 10 years of age over the 2.5 consecutive years of study. Only one JE case was found among 96,920 children 10-11 years old (0.4 per 100,000). Nine children (10%) died and 33 (37%) of the survivors had neurological sequelae at discharge. JEV was transmitted in Bali year-round with 70% of cases in the rainy season. CONCLUSION: JE incidence and case-fatality rates in Bali were comparable to those of other JE-endemic countries of Asia. Our findings contradict the common wisdom that JE is rare in tropical Asia. Hence, the geographical range of endemic JE is broader than previously described. The results of the study support the need to introduce JE vaccination into Bali. [Abstract/Link to Full Text]

Dandona L, Dandona R
What is the global burden of visual impairment?
BMC Med. 2006;46.
BACKGROUND: A recent estimate by the World Health Organization (WHO) suggests that 161 million persons worldwide have visual impairment, including 37 million blind (best-corrected visual acuity less than 3/60 in the better eye) and 124 million with visual impairment less severe than blindness (best-corrected acuity less than 6/18 to 3/60 in the better eye). This estimate is quoted widely, but because it is based on definitions using best-corrected visual acuity, uncorrected refractive error as a cause of visual impairment is excluded. METHODS: We reviewed data from population-based surveys of visual impairment worldwide published 1996 onwards that included presenting visual acuity, and estimated the proportion of visual impairment caused by uncorrected refractive error in different sub-regions of the world. We then extrapolated these data to estimate the worldwide burden of visual impairment including that caused by uncorrected refractive error. RESULTS: The total number of persons with visual impairment worldwide, including that due to uncorrected refractive error, was estimated as 259 million, 61% higher than the commonly quoted WHO estimate. This includes 42 million persons with blindness defined as presenting visual acuity less than 3/60 in the better eye, and 217 million persons with less severe visual impairment level defined as presenting visual acuity less than 6/18 to 3/60 in the better eye, 14% and 75% higher, respectively, than the WHO estimates based on best-corrected visual acuity. Sensitivity analysis, taking into account the uncertainty of the proportion of visual impairment caused by refractive error, revealed that the number of persons in the world with visual impairment due to uncorrected refractive error could range from 82 to 117 million. CONCLUSION: The actual burden of visual impairment worldwide, including that caused by uncorrected refractive error, is substantially higher than the commonly quoted WHO estimate that is based on best-corrected visual acuity. We suggest that the indicative estimate of 259 million persons with visual impairment worldwide, which includes 42 million blind with visual acuity less than 3/60 in the better eye, be used for further planning of the VISION 2020 initiative instead of the often quoted 161 million estimate that includes 37 million blind. [Abstract/Link to Full Text]

Dandona L, Dandona R
Revision of visual impairment definitions in the International Statistical Classification of Diseases.
BMC Med. 2006;47.
BACKGROUND: The existing definitions of visual impairment in the International Statistical Classification of Diseases are based on recommendations made over 30 years ago. New data and knowledge related to visual impairment that have accumulated over this period suggest that these definitions need to be revised. DISCUSSION: Three major issues need to be addressed in the revision of these definitions. First, the existing definitions are based on best-corrected visual acuity, which exclude uncorrected refractive error as a cause of visual impairment, leading to substantial underestimation of the total visual impairment burden by about 38%. Second, the cut-off level of visual impairment to define blindness in the International Statistical Classification of Diseases is visual acuity less than 3/60 in the better eye, but with increasing human development the visual acuity requirements are also increasing, suggesting that a level less than 6/60 be used to define blindness. Third, the International Statistical Classification of Diseases uses the term 'low vision' for visual impairment level less than blindness, which causes confusion with the common use of this term for uncorrectable vision requiring aids or rehabilitation, suggesting that alternative terms such as moderate and mild visual impairment would be more appropriate for visual impairment less severe than blindness. We propose a revision of the definitions of visual impairment in the International Statistical Classification of Diseases that addresses these three issues. According to these revised definitions, the number of blind persons in the world defined as presenting visual acuity less than 6/60 in the better eye would be about 57 million as compared with the World Health Organization estimate of 37 million using the existing International Statistical Classification of Diseases definition of best-corrected visual acuity less than 3/60 in the better eye, and the number of persons in the world with moderate visual impairment defined as presenting visual acuity less than 6/18 to 6/60 in the better eye would be about 202 million as compared with the World Health Organization estimate of 124 million persons with low vision defined as best-corrected visual acuity less than 6/18 to 3/60 in the better eye. CONCLUSION: Our suggested revision of the visual impairment definitions in the International Statistical Classification of Diseases takes into account advances in the understanding of visual impairment. This revised classification seems more appropriate for estimating and tracking visual impairment in the countries and regions of the world than the existing classification in the International Statistical Classification of Diseases. [Abstract/Link to Full Text]

Fensterle J, Trefzer U, Berger T, Andersen MH, Ugurel S, Becker JC
HLA-B8 association with late-stage melanoma--an immunological lesson?
BMC Med. 2006;45.
BACKGROUND: Differences in HLA allele frequencies between the diseased and healthy populations may signify efficient immune responses, a notion that has been successfully tested for infectious diseases or for association with genetic elements involved in a distinct type of immunity. This retrospective study is intended to detect differences in MHC class I carrier frequencies of advanced melanoma patients compared to healthy bone marrow donors. METHODS: The HLA-A and -B carrier frequencies of 748 stage IV melanoma patients retrieved from serotyping at 6 different centers in Germany were compared using a chi-square test to 13,386 fully HLA typed bone marrow donors registered in the German national bone marrow donor registry. RESULTS: The comparison of HLA carrier frequencies in advanced cancer patients with healthy bone marrow donors revealed a significant decrease in HLA-B8 carrier frequencies, which was also apparent in patients with advanced disease compared to patients with loco-regional disease. CONCLUSION: The data suggest that protective immune responses restricted to distinct MHC class I molecules may be operational in a subset of melanoma patients, which is the prerequisite for a large scale screen for the corresponding epitopes. Alternatively, the known association of the ancestral haplotype HLA-A1, -B8 and -DR3 with genetic elements such as distinct TNF-alpha alleles might have a protective effect on disease progression. In any case, identification of the cause of protection within this patient subset might lead to a significant improvement in the efficacy of current immunotherapeutic approaches. [Abstract/Link to Full Text]

Nabulsi MM, Tamim H, Mahfoud Z, Itani M, Sabra R, Chamseddine F, Mikati M
Alternating ibuprofen and acetaminophen in the treatment of febrile children: a pilot study [ISRCTN30487061].
BMC Med. 2006;44.
BACKGROUND: Alternating ibuprofen and acetaminophen for the treatment of febrile children is a prevalent practice among physicians and parents, despite the lack of evidence on effectiveness or safety. This randomized, double-blind and placebo-controlled clinical trial aims at comparing the antipyretic effectiveness and safety of a single administration of alternating ibuprofen and acetaminophen doses to that of ibuprofen mono-therapy in febrile children. METHODS: Seventy febrile children were randomly allocated to receive either a single oral dose of 10 mg/kg ibuprofen and 15 mg/kg oral acetaminophen after 4 hours, or a similar dose of ibuprofen and placebo at 4 hours. Rectal temperature was measured at baseline, 4, 5, 6, 7 and 8 hours later. Endpoints included proportions of afebrile children at 6, 7 and 8 hours, maximum decline in temperature, time to recurrence of fever, and change in temperature from baseline at each time point. Intent-to-treat analysis was planned with statistical significance set at P < 0.05. RESULTS: A higher proportion of subjects in the intervention group (83.3%) became afebrile at 6 hours than in the control group (57.6%); P = 0.018. This difference was accentuated at 7 and 8 hours (P < 0.001) with a significantly longer time to recurrence of fever in the intervention group (mean +/- SD of 7.4 +/- 1.3 versus 5.7 +/- 2.2 hours), P < 0.001. Odds ratios (95%CI) for defervescence were 5.6 (1.3; 23.8), 19.5 (3.5; 108.9) and 15.3 (3.4; 68.3) at 6, 7 and 8 hours respectively. Two-way ANOVA with repeated measures over time revealed a significantly larger decline in temperature in the intervention group at times 7 (P = 0.026) and 8 (P = 0.002) hours. CONCLUSION: A single dose of alternating ibuprofen and acetaminophen appears to be a superior antipyretic regimen than ibuprofen mono-therapy. Further studies are needed to confirm these findings. [Abstract/Link to Full Text]

Small R, Lumley J, Toomey L
Midwife-led debriefing after operative birth: four to six year follow-up of a randomised trial [ISRCTN24648614].
BMC Med. 2006;43.
BACKGROUND: There is little evidence that single-session debriefing is effective in reducing adverse mental health outcomes after trauma. Few trials have included long-term follow-up, but two also suggest possible negative effects of debriefing. We aimed to assess longer-term maternal health outcomes in a trial of midwife-led debriefing following an operative birth, given that findings at six months could not rule out a possible adverse effect of debriefing. METHODS: Four to six years after participating in a midwife-led trial of debriefing following an operative birth, 1039/1041 women were mailed a questionnaire containing the Edinburgh Postnatal Depression Scale (EPDS) and the SF-36 health status measure. RESULTS: Responses were obtained from 534 women (51.4%). Responders from the two trial groups remained comparable 4-6 years postpartum. No significant differences on maternal health outcomes were found between the trial groups. CONCLUSION: In the longer term, maternal health status was neither positively nor adversely affected by the experience of debriefing, despite a hint of adverse effects at six months postpartum. Short debriefing interventions have not proven effective in improving mental health outcomes for women following childbirth. [Abstract/Link to Full Text]

Roberts NJ, Partridge MR
How useful are post consultation letters to patients?
BMC Med. 2006;42.
BACKGROUND: As part of the NHS plan it was suggested that all patients receive copies of letters sent to their General Practitioner following outpatient consultations. The former Secretary of State for Health extended this proposal, suggesting that patients have a specific letter to themselves after a hospital consultation. METHODS: The aim of this study was to send cardiorespiratory patients attending Charing Cross Hospital, a copy of the letter sent to their G.P. plus a specific letter to themselves and to assess the usefulness and comprehensibility of each. The letters were analysed for dictation time, Flesch Reading Ease Score, Flesch-Kincaid Grade Level and word count. Eighty-four out of 105 sequential patients (80%) consented and were sent both types of letter after their attendance. Patients returned both letters circling any items they did not understand and stated a preference for the GP letter, patient letter, or both. The patients' GPs were subsequently also asked for their views on each letter. RESULTS: GP letters took significantly longer to dictate than patient letters. The Flesch Reading Ease Score was significantly higher in the patient letters, indicating that the patient letters were easier to read. The GP letters were significantly longer than the patient letters and patients were significantly more likely to circle more items in the GP letters (p < 0.001). The content of letters is sometimes inaccurate. Thirty-six out of 62 patients (58%) would like to receive both letters, 13/62 (21.6%) would prefer the GP letter and 13/62 (20%) wanted only the patient letter. 45 GPs replied (62.5%), 28/45 (62.5%) wanted the GP letter, 14 GPs (31.1%) wanted both letters and 3/45 (6.7%) wanted the patient letter only. General themes concerned insufficient clinical details and the GPs preferred the structure of the letters written to them. CONCLUSION: Patients appreciate copies of the letter being sent to their GP but comprehension is less good than with a shorter letter written especially to the patient. More attention needs to be paid to making letters to GPs simpler to read without losing the structure and detail liked by GPs. A compromise might be to dictate the letter in front of the patient and to provide a speciality-specific glossary to accompany each letter. [Abstract/Link to Full Text]

Trivedi MA, Schmitz TW, Ries ML, Torgerson BM, Sager MA, Hermann BP, Asthana S, Johnson SC
Reduced hippocampal activation during episodic encoding in middle-aged individuals at genetic risk of Alzheimer's disease: a cross-sectional study.
BMC Med. 2006;41.
BACKGROUND: The presence of the apolipoprotein E (APOE) epsilon4 allele is a major risk factor for the development of Alzheimer's disease (AD), and has been associated with metabolic brain changes several years before the onset of typical AD symptoms. Functional MRI (fMRI) is a brain imaging technique that has been used to demonstrate hippocampal activation during measurement of episodic encoding, but the effect of the epsilon4 allele on hippocampal activation has not been firmly established. METHODS: The present study examined the effects of APOE genotype on brain activation patterns in the medial temporal lobe (MTL) during an episodic encoding task using a well-characterized novel item versus familiar item contrast in cognitively normal, middle-aged (mean = 54 years) individuals who had at least one parent with AD. RESULTS: We found that epsilon3/4 heterozygotes displayed reduced activation in the hippocampus and MTL compared to epsilon3/3 homozygotes. There were no significant differences between the groups in age, education or neuropsychological functioning, suggesting that the altered brain activation seen in epsilon3/4 heterozygotes was not associated with impaired cognitive function. We also found that participants' ability to encode information on a neuropsychological measure of learning was associated with greater activation in the anterior MTL in the epsilon3/3 homozygotes, but not in the epsilon3/4 heterozygotes. CONCLUSION: Together with previous studies reporting reduced glucose metabolism and AD-related neuropathology, this study provides convergent validity for the idea that the MTL exhibits functional decline associated with the APOE epsilon4 allele. Importantly, these changes were detected in the absence of meaningful neuropsychological differences between the groups. A focus of ongoing work in this laboratory is to determine if these findings are predictive of subsequent cognitive decline. [Abstract/Link to Full Text]

Liu-Seifert H, Adams DH, Kinon BJ
Discontinuation of treatment of schizophrenic patients is driven by poor symptom response: a pooled post-hoc analysis of four atypical antipsychotic drugs.
BMC Med. 2005;321.
BACKGROUND: Stopping antipsychotic treatment can interrupt improvement and exacerbate the illness. The reasons for discontinuing treatment during controlled clinical trials were analyzed to explore this phenomenon. METHODS: A post-hoc, pooled analysis was made of 4 randomized, double-blind clinical trials, 24-28 weeks in duration, involving 1627 patients with schizophrenia or a related disorder. Analyses combined all the atypical antipsychotic treatment groups in the studies. RESULTS: The majority of patients (53%) stopped their treatment at an early stage. Poor psychiatric response along with worsening symptoms was the most frequently given reason for discontinuing the course (36%), which was substantially more common than discontinuation due to poor tolerability of the medication (12%). This phenomenon was corroborated by less improvement in patients who discontinued treatment compared with those who completed, based on the PANSS total scores. Discontinuation due to poor response was, apparently, more predominantly linked to patient perception than to physicians' conclusions alone (80% vs. 20%). Discontinuation due to patient perception of poor response appeared to occur particularly early in the course of treatment. Patients who discontinued due to poor toleration of the medication responded in a more comparable manner with completers. CONCLUSION: Discontinuing treatment may lead to exacerbation of symptoms, undermining therapeutic progress. In these studies, poor response to treatment and worsening of underlying psychiatric symptoms, and to a lesser extent, intolerability to medication were the primary contributors to treatment being discontinued. Our findings suggest that adherence may be enhanced by effective symptom control, as objectively measured and as subjectively perceived. Such strategies may improve patients' willingness to undertake long-term therapy and increase the likelihood of a better prognosis. [Abstract/Link to Full Text]

Fleisher DR, Gornowicz B, Adams K, Burch R, Feldman EJ
Cyclic Vomiting Syndrome in 41 adults: the illness, the patients, and problems of management.
BMC Med. 2005;320.
BACKGROUND: Cyclic Vomiting Syndrome (CVS) is a disorder characterized by recurrent, stereotypic episodes of incapacitating nausea, vomiting and other symptoms, separated by intervals of comparative wellness. This report describes the clinical features, co-morbidities and problems encountered in management of 41 adult patients who met the diagnostic criteria for CVS. METHODS: This is a retrospective study of adults with CVS seen between 1994 and 2003. Follow-up data were obtained by mailed questionnaires. RESULTS: Age of onset ranged from 2 to 49 years. The duration of CVS at the time of consultation ranged from less than 1 year to 49 years. CVS episodes were stereotypic in respect of their hours of onset, symptomatology and length. Ninety-three percent of patients had recognizable prodromes. Half of the patients experienced a constellation of symptoms consisting of CVS episodes, migraine diathesis, inter-episodic dyspeptic nausea and a history of panic attacks. Deterioration in the course of CVS is indicated by coalescence of episodes in time. The prognosis of CVS is favorable in the majority of patients. CONCLUSION: CVS is a disabling disorder affecting adults as well as children. Because its occurrence in adults is little known, patients experience delayed or mis-diagnosis and ineffectual, sometimes inappropriately invasive management. [Abstract/Link to Full Text]

Reeves WC, Wagner D, Nisenbaum R, Jones JF, Gurbaxani B, Solomon L, Papanicolaou DA, Unger ER, Vernon SD, Heim C
Chronic fatigue syndrome--a clinically empirical approach to its definition and study.
BMC Med. 2005;319.
BACKGROUND: The lack of standardized criteria for defining chronic fatigue syndrome (CFS) has constrained research. The objective of this study was to apply the 1994 CFS criteria by standardized reproducible criteria. METHODS: This population-based case control study enrolled 227 adults identified from the population of Wichita with: (1) CFS (n = 58); (2) non-fatigued controls matched to CFS on sex, race, age and body mass index (n = 55); (3) persons with medically unexplained fatigue not CFS, which we term ISF (n = 59); (4) CFS accompanied by melancholic depression (n = 27); and (5) ISF plus melancholic depression (n = 28). Participants were admitted to a hospital for two days and underwent medical history and physical examination, the Diagnostic Interview Schedule, and laboratory testing to identify medical and psychiatric conditions exclusionary for CFS. Illness classification at the time of the clinical study utilized two algorithms: (1) the same criteria as in the surveillance study; (2) a standardized clinically empirical algorithm based on quantitative assessment of the major domains of CFS (impairment, fatigue, and accompanying symptoms). RESULTS: One hundred and sixty-four participants had no exclusionary conditions at the time of this study. Clinically empirical classification identified 43 subjects as CFS, 57 as ISF, and 64 as not ill. There was minimal association between the empirical classification and classification by the surveillance criteria. Subjects empirically classified as CFS had significantly worse impairment (evaluated by the SF-36), more severe fatigue (documented by the multidimensional fatigue inventory), more frequent and severe accompanying symptoms than those with ISF, who in turn had significantly worse scores than the not ill; this was not true for classification by the surveillance algorithm. CONCLUSION: The empirical definition includes all aspects of CFS specified in the 1994 case definition and identifies persons with CFS in a precise manner that can be readily reproduced by both investigators and clinicians. [Abstract/Link to Full Text]

Broen AN, Moum T, B�dtker AS, Ekeberg O
The course of mental health after miscarriage and induced abortion: a longitudinal, five-year follow-up study.
BMC Med. 2005;318.
BACKGROUND: Miscarriage and induced abortion are life events that can potentially cause mental distress. The objective of this study was to determine whether there are differences in the patterns of normalization of mental health scores after these two pregnancy termination events. METHODS: Forty women who experienced miscarriages and 80 women who underwent abortions at the main hospital of Buskerud County in Norway were interviewed. All subjects completed the following questionnaires 10 days (T1), six months (T2), two years (T3) and five years (T4) after the pregnancy termination: Impact of Event Scale (IES), Quality of Life, Hospital Anxiety and Depression Scale (HADS), and another addressing their feelings about the pregnancy termination. Differential changes in mean scores were determined by analysis of covariance (ANCOVA) and inter-group differences were assessed by ordinary least squares methods. RESULTS: Women who had experienced a miscarriage had more mental distress at 10 days and six months after the pregnancy termination than women who had undergone an abortion. However, women who had had a miscarriage exhibited significantly quicker improvement on IES scores for avoidance, grief, loss, guilt and anger throughout the observation period. Women who experienced induced abortion had significantly greater IES scores for avoidance and for the feelings of guilt, shame and relief than the miscarriage group at two and five years after the pregnancy termination (IES avoidance means: 3.2 vs 9.3 at T3, respectively, p < 0.001; 1.5 vs 8.3 at T4, respectively, p < 0.001). Compared with the general population, women who had undergone induced abortion had significantly higher HADS anxiety scores at all four interviews (p < 0.01 to p < 0.001), while women who had had a miscarriage had significantly higher anxiety scores only at T1 (p < 0.01). CONCLUSION: The course of psychological responses to miscarriage and abortion differed during the five-year period after the event. Women who had undergone an abortion exhibited higher scores during the follow-up period for some outcomes. The difference in the courses of responses may partly result from the different characteristics of the two pregnancy termination events. [Abstract/Link to Full Text]

Garc�a Rodr�guez LA, Gonz�lez-P�rez A
Long-term use of non-steroidal anti-inflammatory drugs and the risk of myocardial infarction in the general population.
BMC Med. 2005;317.
BACKGROUND: Recent data indicate that chronic use of coxibs leads to an increased occurrence of thrombotic cardiovascular events. This raises the question as to whether traditional non-steroidal anti-inflammatory drugs (tNSAIDs) might also produce similar hazards. Our aim has been to evaluate the association between the chronic use of tNSAIDs and the risk of myocardial infarction (MI) in patients. METHODS: We performed a nested case-control analysis with 4,975 cases of acute MI and 20,000 controls, frequency matched to cases by age, sex, and calendar year. RESULTS: Overall, current use of tNSAID was not associated with an increased risk of MI (RR:1.07;95%CI: 0.95-1.21). However, we found that the relative risk (RR) of MI for durations of tNSAID treatment of >1 year was 1.21 (95% CI, 1.00-1.48). The corresponding RR was 1.34 (95% CI, 1.06-1.70) for non-fatal MI. The effect was independent from dose. The small risk associated with long-term use of tNSAIDs was observed among patients not taking low-dose aspirin (RR: 1.29; 95% CI, 1.01-1.65). The effect of long-term use for individual tNSAIDs ranged from a RR of 0.87 (95% CI, 0.47-1.62) with naproxen to 1.38 (95% CI, 1.00-1.90) with diclofenac. CONCLUSION: This study adds support to the hypothesis that chronic treatment with some tNSAIDs is associated with a small increased risk of non-fatal MI. Our data are consistent with a substantial variability in cardiovascular risks between individual tNSAIDs. [Abstract/Link to Full Text]

Hem E, Stokke G, Tyssen R, Gr�nvold NT, Vaglum P, Ekeberg �
Self-prescribing among young Norwegian doctors: a nine-year follow-up study of a nationwide sample.
BMC Med. 2005;316.
BACKGROUND: Self-prescribing among doctors is common, but no longitudinal studies have documented this issue. We studied the self-prescribing behaviour among young Norwegian physicians and the predictors of self-prescribing. METHODS: We conducted a nationwide, prospective and longitudinal study following young Norwegian physicians from internship through the subsequent nine years using three postal questionnaires. Chi-square tests and logistic regression models were applied. RESULTS: About 54% of the physicians in their fourth and ninth postgraduate years had self-prescribed medication at least once during the previous year. Among those who had used prescription medication during the previous year, about 90% had self-prescribed. Self-prescribing behaviour did not differ significantly between men and women, or according to the type of work at any time. The most frequently self-prescribed medications were antibiotics (71%-81%), contraceptives (24%-25%), analgesics (18%-21%), and hypnotics (9%-12%). Those who had needed treatment for mental problems had self-prescribed hypnotics and sedatives to a greater extent than the others. Being male, having self-prescribed during internship, somatic complaints, mental distress, subjective health complaints, and not having sought help from a general practitioner, were significant adjusted predictors of self-prescribing in the ninth postgraduate year. CONCLUSION: The level of self-prescribing among young Norwegian physicians is relatively high, and this behaviour is established early in their professional lives. Although self-prescribing is acceptable in some situations, physicians should seek professional help for illness. Efforts to inculcate more rational help-seeking behaviour should probably start in medical schools. [Abstract/Link to Full Text]

Adams CE, Rathbone J, Thornley B, Clarke M, Borrill J, Wahlbeck K, Awad AG
Chlorpromazine for schizophrenia: a Cochrane systematic review of 50 years of randomised controlled trials.
BMC Med. 2005;315.
BACKGROUND: Chlorpromazine (CPZ) remains one of the most common drugs used for people with schizophrenia worldwide, and a benchmark against which other treatments can be evaluated. Quantitative reviews are rare; this one evaluates the effects of chlorpromazine in the treatment of schizophrenia in comparison with placebo. METHODS: We sought all relevant randomised controlled trials (RCT) comparing chlorpromazine to placebo by electronic and reference searching, and by contacting trial authors and the pharmaceutical industry. Data were extracted from selected trials and, where possible, synthesised and random effects relative risk (RR), the number needed to treat (NNT) and their 95% confidence intervals (CI) calculated. RESULTS: Fifty RCTs from 1955-2000 were included with 5276 people randomised to CPZ or placebo. They constitute 2008 person-years spent in trials. Meta-analysis of these trials showed that chlorpromazine promotes a global improvement (n = 1121, 13 RCTs, RR 0.76 CI 0.7 to 0.9, NNT 7 CI 5 to 10), although a considerable placebo response is also seen. People allocated to chlorpromazine tended not to leave trials early in both the short (n = 945, 16 RCTs, RR 0.74 CI 0.5 to 1.1) and medium term (n = 1861, 25 RCTs, RR 0.79 CI 0.6 to 1.1). There were, however, many adverse effects. Chlorpromazine is sedating (n = 1242, 18 RCTs, RR 2.3 CI 1.7 to 3.1, NNH 6 CI 5 to 8), increases a person's chances of experiencing acute movement disorders, Parkinsonism and causes low blood pressure with dizziness and dry mouth. CONCLUSION: It is understandable why the World Health Organization (WHO) have endorsed and included chlorpromazine in their list of essential drugs for use in schizophrenia. Low- and middle-income countries may have more complete evidence upon which to base their practice compared with richer nations using recent innovations. [Abstract/Link to Full Text]

Aursnes I, Tvete IF, Gaasemyr J, Natvig B
Suicide attempts in clinical trials with paroxetine randomised against placebo.
BMC Med. 2005;314.
BACKGROUND: Inclusion of unpublished data on the effects of antidepressants on children has suggested unfavourable risk-benefit profiles for some of the drugs. Recent meta-analyses of studies on adults have indicated similar effects. We obtained unpublished data for paroxetine that have so far not been included in these analyses. METHODS: The documentation for drug registration contained 16 studies in which paroxetine had been randomised against placebo. We registered the number of suicides, suicide attempts and ideation. We corrected for duration of medication and placebo treatment and used a standard Bayesian statistical approach with varying priors. RESULTS: There were 7 suicide attempts in patients on the drug and 1 in a patient on placebo. We found that the probability of increased intensity of suicide attempts per year in adults taking paroxetine was 0.90 with a "pessimistic" prior, and somewhat less with two more neutral priors. CONCLUSION: Our findings support the results of recent meta-analyses. Patients and doctors should be warned that the increased suicidal activity observed in children and adolescents taking certain antidepressant drugs may also be present in adults. [Abstract/Link to Full Text]

McManus IC, Mollon J, Duke OL, Vale JA
Changes in standard of candidates taking the MRCP(UK) Part 1 examination, 1985 to 2002: analysis of marker questions.
BMC Med. 2005;313.
BACKGROUND: The maintenance of standards is a problem for postgraduate medical examinations, particularly if they use norm-referencing as the sole method of standard setting. In each of its diets, the MRCP(UK) Part 1 Examination includes a number of marker questions, which are unchanged from their use in a previous diet. This paper describes two complementary studies of marker questions for 52 diets of the MRCP(UK) Part 1 Examination over the years 1985 to 2001 to assess whether standards have changed. METHODS: Study 1, which used routinely collected information on the performance of 4405 marker items, used a statistical method to assess changes in performance across diets. Study 2 compared performances of individual candidates on 28 individual marker items that were shared by the 1996/2 and 2001/3 diets. RESULTS: Study 1 found evidence that candidate performance on the MRCP(UK) Part 1 Examination showed a gradual improvement over the period 1985 to 1997, which was followed by a sharp decline in performance until 2001. The 'dog-leg' in performance at 1997/3 was not an artefact of changed Examination Regulations, mix of UK and overseas candidates, or time from qualification until taking the Examination. Study 2 confirmed that performance in 2001/3 was significantly worse than in 1996/3, that the poorer performance was found in graduates of UK medical schools, and that candidates passing the Examination in 2001/3 performed less well than those passing in 1996/2. CONCLUSION: There has been a decline in the performance of graduates from UK medical schools taking the MRCP(UK) Part 1 examination. The reasons for this are not clear, but the finding has implications for medical education, and further studies are needed of performance in other postgraduate and undergraduate examinations. The use of norm-referencing as the sole method for setting the pass mark over this period meant that candidates passing the MRCP(UK) examination also had a lower standard. The MRCP(UK) Part 1 and Part 2 examinations now have their standard set by criterion-referencing. [Abstract/Link to Full Text]

Jorm AF, Nakane Y, Christensen H, Yoshioka K, Griffiths KM, Wata Y
Public beliefs about treatment and outcome of mental disorders: a comparison of Australia and Japan.
BMC Med. 2005;312.
BACKGROUND: Surveys of the public in a number of countries have shown poor recognition of mental disorders and beliefs about treatment that often diverge from those of health professionals. This lack of mental health literacy can limit the optimal use of treatment services. Australia and Japan are countries with very different mental health care systems, with Japan emphasising hospital care and Australia more oriented to community care. Japan is also more collectivist and Australia more individualist in values. These differences might influence recognition of disorders and beliefs about treatment in the two countries. METHODS: Surveys of the public were carried out in each country using as similar a methodology as feasible. In both countries, household interviews were carried out concerning beliefs in relation to one of four case vignettes, describing either depression, depression with suicidal thoughts, early schizophrenia or chronic schizophrenia. In Australia, the survey involved a national sample of 3998 adults aged 18 years or over. In Japan, the survey involved 2000 adults aged between 20 and 69 from 25 regional sites spread across the country. RESULTS: The Japanese public were found to be more reluctant to use psychiatric labels, particularly for the depression cases. The Japanese were also more reluctant to discuss mental disorders with others outside the family. They had a strong belief in counsellors, but not in GPs. They generally believe in the benefits of treatment, but are not optimistic about full recovery. By contrast, Australians used psychiatric labels more often, particularly "depression". They were also more positive about the benefits of seeking professional help, but had a strong preference for lifestyle interventions and tended to be negative about some psychiatric medications. Australians were positive about both counsellors and GPs. Psychiatric hospitalization and ECT were seen negatively in both countries. CONCLUSION: There are some major differences between Australia and Japan in recognition of disorders and beliefs about treatment. Some of these may relate to the different health care systems, but the increasing openness about mental health in Australia is also likely to be an explanatory factor. [Abstract/Link to Full Text]

Diau GY, Hsieh AT, Sarkadi-Nagy EA, Wijendran V, Nathanielsz PW, Brenna JT
The influence of long chain polyunsaturate supplementation on docosahexaenoic acid and arachidonic acid in baboon neonate central nervous system.
BMC Med. 2005;311.
BACKGROUND: Docosahexaenoic acid (DHA) and arachidonic acid (ARA) are major components of the cerebral cortex and visual system, where they play a critical role in neural development. We quantitatively mapped fatty acids in 26 regions of the four-week-old breastfed baboon CNS, and studied the influence of dietary DHA and ARA supplementation and prematurity on CNS DHA and ARA concentrations. METHODS: Baboons were randomized into a breastfed (B) and four formula-fed groups: term, no DHA/ARA (T-); term, DHA/ARA supplemented (T+); preterm, no DHA/ARA (P-); preterm and DHA/ARA supplemented (P+). At four weeks adjusted age, brains were dissected and total fatty acids analyzed by gas chromatography and mass spectrometry. RESULTS: DHA and ARA are rich in many more structures than previously reported. They are most concentrated in structures local to the brain stem and diencephalon, particularly the basal ganglia, limbic regions, thalamus and midbrain, and comparatively lower in white matter. Dietary supplementation increased DHA in all structures but had little influence on ARA concentrations. Supplementation restored DHA concentrations to levels of breastfed neonates in all regions except the cerebral cortex and cerebellum. Prematurity per se did not exert a strong influence on DHA or ARA concentrations. CONCLUSION: 1) DHA and ARA are found in high concentration throughout the primate CNS, particularly in gray matter such as basal ganglia; 2) DHA concentrations drop across most CNS structures in neonates consuming formulas with no DHA, but ARA levels are relatively immune to ARA in the diet; 3) supplementation of infant formula is effective at restoring DHA concentration in structures other than the cerebral cortex. These results will be useful as a guide to future investigations of CNS function in the absence of dietary DHA and ARA. [Abstract/Link to Full Text]

Kim JY, Siegmund KD, Tavar� S, Shibata D
Age-related human small intestine methylation: evidence for stem cell niches.
BMC Med. 2005;310.
BACKGROUND: The small intestine is constructed of many crypts and villi, and mouse studies suggest that each crypt contains multiple stem cells. Very little is known about human small intestines because mouse fate mapping strategies are impractical in humans. However, it is theoretically possible that stem cell histories are inherently written within their genomes. Genomes appear to record histories (as exemplified by use of molecular clocks), and therefore it may be possible to reconstruct somatic cell dynamics from somatic cell errors. Recent human colon studies suggest that random somatic epigenetic errors record stem cell histories (ancestry and total numbers of divisions). Potentially age-related methylation also occurs in human small intestines, which would allow characterization of their stem cells and comparisons with the colon. METHODS: Methylation patterns in individual crypts from 13 small intestines (17 to 78 years old) were measured by bisulfite sequencing. The methylation patterns were analyzed by a quantitative model to distinguish between immortal or niche stem cell lineages. RESULTS: Age-related methylation was observed in the human small intestines. Crypt methylation patterns were more consistent with stem cell niches than immortal stem cell lineages. Human large and small intestine crypt niches appeared to have similar stem cell dynamics, but relatively less methylation accumulated with age in the small intestines. There were no apparent stem cell differences between the duodenum and ileum, and stem cell survival did not appear to decline with aging. CONCLUSION: Crypt niches containing multiple stem cells appear to maintain human small intestines. Crypt niches appear similar in the colon and small intestine, and the small intestinal stem cell mitotic rate is the same as or perhaps slower than that of the colon. Although further studies are needed, age-related methylation appears to record somatic cell histories, and a somatic epigenetic molecular clock strategy may potentially be applied to other human tissues to reconstruct otherwise occult stem cell histories. [Abstract/Link to Full Text]

van der Horst IC, Ottervanger JP, van 't Hof AW, Reiffers S, Miedema K, Hoorntje JC, Dambrink JH, Gosselink AT, Nijsten MW, Suryapranata H, de Boer MJ, Zijlstra F
The impact of glucose-insulin-potassium infusion in acute myocardial infarction on infarct size and left ventricular ejection fraction [ISRCTN56720616].
BMC Med. 2005;39.
BACKGROUND: Favorable clinical outcomes have been observed with glucose-insulin-potassium infusion (GIK) in acute myocardial infarction (MI). The mechanisms of this beneficial effect have not been delineated clearly. GIK has metabolic, anti-inflammatory and profibrinolytic effects and it may preserve the ischemic myocardium. We sought to assess the effect of GIK infusion on infarct size and left ventricular function, as part of a randomized controlled trial. METHODS: Patients (n = 940) treated for acute MI by primary percutaneous coronary intervention (PCI) were randomized to GIK infusion or no infusion. Endpoints were the creatinine kinase MB-fraction (CK-MB) and left ventricular ejection fraction (LVEF). CK-MB levels were determined 0, 2, 4, 6, 24, 48, 72 and 96 hours after admission and the LVEF was measured before discharge. RESULTS: There were no differences between the two groups in the time course or magnitude of CK-MB release: the peak CK-MB level was 249 +/- 228 U/L in the GIK group and 240 +/- 200 U/L in the control group (NS). The mean LVEF was 43.7 +/- 11.0 % in the GIK group and 42.4 +/- 11.7% in the control group (P = 0.12). A LVEF < or = 30% was observed in 18% in the controls and in 12% of the GIK group (P = 0.01). CONCLUSION: Treatment with GIK has no effect on myocardial function as determined by LVEF and by the pattern or magnitude of enzyme release. However, left ventricular function was preserved in GIK treated patients. [Abstract/Link to Full Text]

Alander T, Sv�rdsudd K, Johansson SE, Agr�us L
Psychological illness is commonly associated with functional gastrointestinal disorders and is important to consider during patient consultation: a population-based study.
BMC Med. 2005;38.
BACKGROUND: Some individuals with functional gastrointestinal disorders (FGID) suffer long-lasting symptoms without ever consulting their doctors. Our aim was to study co-morbidity and lifestyle differences among consulters and non-consulters with persistent FGID and controls in a defined adult population. METHODS: A random sample of the general adult Swedish population was obtained by a postal questionnaire. The Abdominal Symptom Questionnaire (ASQ) was used to measure GI symptomatology and grade of GI symptom severity and the Complaint Score Questionnaire (CSQ) was used to measure general symptoms. Subjects were then grouped for study by their symptomatic profiles. Subjects with long-standing FGID (n = 141) and subjects strictly free from gastrointestinal (GI) symptoms (n = 97) were invited to attend their local health centers for further assessment. RESULTS: Subjects with FGID have a higher risk of psychological illness [OR 8.4, CI95(4.0-17.5)] than somatic illness [OR 2.8, CI95(1.3-5.7)] or ache and fatigue symptoms [OR 4.3, CI95(2.1-8.7)]. Subjects with psychological illness have a higher risk of severe GI symptoms than controls; moreover they have a greater chance of being consulters. Patients with FGID have more severe GI symptoms than non-patients. CONCLUSION: There is a strong relation between extra-intestinal, mental and somatic complaints and FGID in both patients and non-patients. Psychological illness increases the chance of concomitantly having more severe GI symptoms, which also enhance consultation behaviour. [Abstract/Link to Full Text]

Wilczynski NL, Haynes RB
EMBASE search strategies for identifying methodologically sound diagnostic studies for use by clinicians and researchers.
BMC Med. 2005;37.
BACKGROUND: Accurate diagnosis by clinicians is the cornerstone of decision making for recommending clinical interventions. The current best evidence from research concerning diagnostic tests changes unpredictably as science advances. Both clinicians and researchers need dependable access to published evidence concerning diagnostic accuracy. Bibliographic databases such as EMBASE provide the most widely available entr�e to this literature. The objective of this study was to develop search strategies that optimize the retrieval of methodologically sound diagnostic studies from EMBASE for use by clinicians. METHODS: An analytic survey was conducted, comparing hand searches of 55 journals with retrievals from EMBASE for 4,843 candidate search terms and 6,574 combinations. All articles were rated using purpose and quality indicators, and clinically relevant diagnostic accuracy articles were categorized as 'pass' or 'fail' according to explicit criteria for scientific merit. Candidate search strategies were run in EMBASE, the retrievals being compared with the hand search data. The proposed search strategies were treated as "diagnostic tests" for sound studies and the manual review of the literature was treated as the "gold standard." The sensitivity, specificity, precision and accuracy of the search strategies were calculated. RESULTS: Of the 433 articles about diagnostic tests, 97 (22.4%) met basic criteria for scientific merit. Combinations of search terms reached peak sensitivities of 100% with specificity at 70.4%. Compared with best single terms, best multiple terms increased sensitivity for sound studies by 8.2% (absolute increase), but decreased specificity (absolute decrease 6%) when sensitivity was maximized. When terms were combined to maximize specificity, the single term "specificity.tw." (specificity of 98.2%) outperformed combinations of terms. CONCLUSION: Empirically derived search strategies combining indexing terms and textwords can achieve high sensitivity and specificity for retrieving sound diagnostic studies from EMBASE. These search filters will enhance the searching efforts of clinicians. [Abstract/Link to Full Text]

The effects of cholesterol lowering with simvastatin on cause-specific mortality and on cancer incidence in 20,536 high-risk people: a randomised placebo-controlled trial [ISRCTN48489393].
BMC Med. 2005;36.
BACKGROUND: There have been concerns that low blood cholesterol concentrations may cause non-vascular mortality and morbidity. Randomisation of large numbers of people to receive a large, and prolonged, reduction in cholesterol concentrations provides an opportunity to address such concerns reliably. METHODS: 20,536 UK adults (aged 40-80 years) with vascular disease or diabetes were randomly allocated to receive 40 mg simvastatin daily or matching placebo. Prespecified safety analyses were of cause-specific mortality, and of total and site-specific cancer incidence. Comparisons between all simvastatin-allocated versus all placebo-allocated participants (ie, "intention-to-treat") involved an average difference in blood total cholesterol concentration of 1.2 mmol/L (46 mg/dL) during the scheduled 5-year treatment period. RESULTS: There was a highly significant 17% (95% CI 9-25) proportional reduction in vascular deaths, along with a non-significant reduction in all non-vascular deaths, which translated into a significant reduction in all-cause mortality (p = 0.0003). The proportional reduction in the vascular mortality rate was about one-sixth in each subcategory of participant studied, including: men and women; under and over 70 years at entry; and total cholesterol below 5.0 mmol/L or LDL cholesterol below 3.0 mmol/L. No significant excess of non-vascular mortality was observed in any subcategory of participant (including the elderly and those with pretreatment total cholesterol below 5.0 mmol/L), and there was no significant excess in any particular cause of non-vascular mortality. Cancer incidence rates were similar in the two groups, both overall and in particular subcategories of participant, as well as at particular primary sites. There was no suggestion that any adverse trends in non-vascular mortality or morbidity were beginning to emerge with more prolonged treatment. CONCLUSION: These findings, which are based on large numbers of deaths and non-fatal cancers, provide considerable reassurance that lowering total cholesterol concentrations by more than 1 mmol/L for an average of 5 years does not produce adverse effects on non-vascular mortality or cancer incidence. Moreover, among the many different types of high-risk individual studied, simvastatin 40 mg daily consistently produced substantial reductions in vascular (and, hence, all-cause) mortality, as well as in the rates of non-fatal heart attacks, strokes and revascularisation procedures. [Abstract/Link to Full Text]

Recent Articles in BMC Complementary and Alternative Medicine

Gardiner P, Woods C, Kemper KJ
Dietary supplement use among health care professionals enrolled in an online curriculum on herbs and dietary supplements.
BMC Complement Altern Med. 2006;621.
BACKGROUND: Although many health care professionals (HCPs) in the United States have been educated about and recommend dietary supplements, little is known about their personal use of dietary supplements and factors associated with their use. METHODS: We surveyed HCPs at the point of their enrollment in an on-line course about dietary supplements between September, 2004 and May, 2005. We used multivariable logistic regression to analyze demographic and practice factors associated with use of dietary supplements. RESULTS: Of the 1249 health care professionals surveyed, 81 % reported having used a vitamin, mineral, or other non-herbal dietary supplements in the last week. Use varied by profession with highest rates among nurses (88%), physician assistants or nurse practitioners (84 %) and the lowest rates among pharmacists (66%) and trainees (72%). The most frequently used supplements were multivitamins (60%), calcium (40%), vitamin B (31%), vitamin C (30%), and fish oil (24%). Factors associated with higher supplement use were older age, female, high knowledge of dietary supplements, and discussing dietary supplements with patients. In our adjusted model, nurses were more likely than other professionals to use a multivitamin and students were more likely to use calcium. CONCLUSION: Among HCPs enrolled in an on-line course about dietary supplements, women, older clinicians, those with higher knowledge and those who talk with patients about dietary supplements had higher use of dietary supplements. Additional research is necessary to understand the impact of professionals' personal use of dietary supplements on communication with patients about them. [Abstract/Link to Full Text]

Dahlin L, Lund I, Lundeberg T, Molander C
Vibratory stimulation increase the electro-cutaneous sensory detection and pain thresholds in women but not in men.
BMC Complement Altern Med. 2006;620.
BACKGROUND: Vibratory stimulation is a potential method for the treatment of pain. METHODS: The effect of vibration on the forearm on detection (DT) and pain thresholds (PT) induced by electro-cutaneous stimulation were investigated in healthy male and female volunteers. RESULTS: Women have lower baseline detection and pain thresholds as compared to men. Furthermore, women but not men report increased detection and pain thresholds after vibratory stimulation. CONCLUSION: Our findings indicate the potential usefulness of vibratory stimulation for pain treatment, and that gender differences should be considered in future evaluation of the method. [Abstract/Link to Full Text]

Joos S, Rosemann T, Szecsenyi J, Hahn EG, Willich SN, Brinkhaus B
Use of complementary and alternative medicine in Germany - a survey of patients with inflammatory bowel disease.
BMC Complement Altern Med. 2006;619.
BACKGROUND: Previous studies have suggested an increasing use of complementary and alternative medicine (CAM) in patients with inflammatory bowel disease (IBD). The aim of our study was to evaluate the use of CAM in German patients with IBD. METHODS: A questionnaire was offered to IBD patients participating in patient workshops which were organized by a self-help association, the German Crohn's and Colitis Association. The self-administered questionnaire included demographic and disease-related data as well as items analysing the extent of CAM use and satisfaction with CAM treatment. Seven commonly used CAM methods were predetermined on the questionnaire. RESULTS: 413 questionnaires were completed and included in the analysis (n = 153 male, n = 260 female; n = 246 Crohn's disease, n = 164 ulcerative colitis). 52 % of the patients reported CAM use in the present or past. In detail, homeopathy (55%), probiotics (43%), classical naturopathy (38%), Boswellia serrata extracts (36%) and acupuncture/Traditional Chinese Medicine (TCM) (33%) were the most frequently used CAM methods. Patients using probiotics, acupuncture and Boswellia serrata extracts (incense) reported more positive therapeutic effects than others. Within the statistical analysis no significant predictors for CAM use were found. 77% of the patients felt insufficiently informed about CAM. CONCLUSION: The use of CAM in IBD patients is very common in Germany, although a large proportion of patients felt that information about CAM is not sufficient. However, to provide an evidence-based approach more research in this field is desperately needed. Therefore, physicians should increasingly inform IBD patients about benefits and limitations of CAM treatment. [Abstract/Link to Full Text]

Moss K, Boon H, Ballantyne P, Kachan N
New Canadian natural health product regulations: a qualitative study of how CAM practitioners perceive they will be impacted.
BMC Complement Altern Med. 2006;618.
BACKGROUND: New Canadian policy to regulate natural health products (NHPs), such as herbs and vitamins were implemented on January 1st, 2004. We explored complementary and alternative medicine (CAM) practitioners' perceptions of how the new regulations may affect their practices and relationships with patients/consumers. METHODS: This was an applied ethnographic study. Data were collected in fall 2004 via qualitative interviews with 37 Canadian leaders of four CAM groups that use natural products as a core part of their practises: naturopathic medicine, traditional Chinese medicine (TCM), homeopathic medicine and Western herbalism. All interviews were transcribed verbatim and coded independently by a minimum of two investigators using content analysis. RESULTS: Three key findings emerged from the data: 1) all CAM leaders were concerned with issues of their own access to NHPs; 2) all the CAM leaders, except for the homeopathic leaders, specifically indicated a desire to have a restricted schedule of NHPs; and 3) only naturopathic leaders were concerned the NHP regulations could potentially endanger patients if they self-medicate incorrectly. CONCLUSION: Naturopaths, TCM practitioners, homeopaths, and Western herbalists were all concerned about how the new NHP regulations will affect their access to the products they need to practice effectively. Additional research will need to focus on what impacts actually occur as the regulations are implemented more fully. [Abstract/Link to Full Text]

Rao NK, Nammi S
Antidiabetic and renoprotective effects of the chloroform extract of Terminalia chebula Retz. seeds in streptozotocin-induced diabetic rats.
BMC Complement Altern Med. 2006;617.
BACKGROUND: Terminalia chebula (Combretaceae) has been widely used in Ayurveda for the treatment of diabetes. In the present investigation, the chloroform extract of T. chebula seed powder was investigated for its antidiabetic activity in streptozotocin-induced diabetic rats using short term and long term study protocols. The efficacy of the extract was also evaluated for protection of renal functions in diabetic rats. METHODS: The blood glucose lowering activity of the chloroform extract was determined in streptozotocin-induced (75 mg/kg, i.p.; dissolved in 0.1 M acetate buffer; pH 4.5) diabetic rats, after oral administration at the doses of 100, 200 and 300 mg/kg in short term study. Blood samples were collected from the eye retro-orbital plexus of rats before and also at 0.5, 1, 2, 4, 6, 8 and 12 h after drug administration and the samples were analyzed for blood glucose by using glucose-oxidase/peroxidase method using a visible spectrophotometer. In long term study, the extract (300 mg/kg) was administered to streptozotocin-induced diabetic rats, daily for 8 weeks. Blood glucose was measured at weekly intervals for 4 weeks. Urine samples were collected before the induction of diabetes and at the end of 8 weeks of treatments and analyzed for urinary protein, albumin and creatinine levels. The data was compared statistically using one-way ANOVA with post-hoc Dunnet's t-test. RESULTS: The chloroform extract of T. chebula seeds produced dose-dependent reduction in blood glucose of diabetic rats and comparable with that of standard drug, glibenclamide in short term study. It also produced significant reduction in blood glucose in long term study. Significant renoprotective activity is observed in T. chebula treated rats. The results indicate a prolonged action in reduction of blood glucose by T. chebula and is probably mediated through enhanced secretion of insulin from the beta-cells of Langerhans or through extra pancreatic mechanism. The probable mechanism of potent renoprotective actions of T. chebula has to be evaluated. CONCLUSION: The present studies clearly indicated a significant antidiabetic and renoprotective effects with the chloroform extract of T. chebula and lend support for its traditional usage. Further investigations on identification of the active principles and their mode of action are needed to unravel the molecular mechanisms involved in the observed effects. [Abstract/Link to Full Text]

Crawford NW, Cincotta DR, Lim A, Powell CV
A cross-sectional survey of complementary and alternative medicine use by children and adolescents attending the University Hospital of Wales.
BMC Complement Altern Med. 2006;616.
BACKGROUND: A high prevalence of CAM use has been documented worldwide in children and adolescents with chronic illnesses. Only a small number of studies, however, have been conducted in the United Kingdom. The primary aim of this study was to examine the use of CAM by children and adolescents with a wide spectrum of acute and chronic medical problems in a tertiary children's hospital in Wales. METHODS: Structured personal interviews of 100 inpatients and 400 outpatients were conducted over a 2-month period in 2004. The yearly and monthly prevalence of CAM use were assessed and divided into medicinal and non-medicinal therapies. This use was correlated with socio-demographic factors. RESULTS: There were 580 patients approached to attain 500 completed questionnaires. The use of at least one type of CAM in the past year was 41% (95% CI 37-46%) and past month 26% (95% CI 23-30%). The yearly prevalence of medicinal CAM was 38% and non-medicinal 12%. The users were more likely to have parents that were tertiary educated (mother: OR = 2.3, 95%CI 1.6-3.3) and a higher family income (Pearson chi-square for trend = 14.3, p < 0.001). The most common medicinal types of CAM were non-prescribed vitamins and minerals (23%) and herbal therapies (10%). Aromatherapy (5%) and reflexology (3%) were the most prevalent non-medicinal CAMs.None of the inpatient medical records documented CAM use in the past month. Fifty-two percent of medicinal and 38% of non-medicinal CAM users felt their doctor did not need to know about CAM use. Sixty-six percent of CAM users did not disclose the fact to their doctor. Three percent of all participants were using herbs and prescription medicines concurrently. CONCLUSION: There is a high prevalence of CAM use in our study population. Paediatricians need to ensure that they ask parents and older children about their CAM usage and advise caution with regard to potential interactions.CAM is a rapidly expanding industry that requires further evidence-based research to provide more information on the effectiveness and safety of many CAM therapies. Statutory or self-regulation of the different segments of the industry is important. Integration of CAM with allopathic western medicine through education and better communication is slowly progressing. [Abstract/Link to Full Text]

Kemper KJ, Gardiner P, Gobble J, Woods C
Expertise about herbs and dietary supplements among diverse health professionals.
BMC Complement Altern Med. 2006;615.
BACKGROUND: Herbs and other dietary supplements are among the most commonly used complementary medical therapies. However, clinicians generally have limited knowledge, confidence and communication about herbs and dietary supplements (HDS). We compared diverse clinicians' expertise about HDS to better target future curricula. METHODS: We conducted a cross-sectional survey of physicians, pharmacists, nurses, dietitians and trainees in these professions prior to e-curriculum about HDS in 2004-2005. The survey had 28 questions about knowledge, 19 questions about their confidence and 11 questions about their communication practices about HDS. RESULTS: Of the 1,268 participants, 25% were male; the average age was 40 years. Mean scores were 66% correct for knowledge; 53/95 on the confidence scale and 2.2 out of possible 10 on the communication practices scale. On average, scores were lowest for those who used fewer HDS; and trainees and nurses compared with physicians, pharmacists and dietitians (P < 0.01 for all comparisons). CONCLUSION: Clinicians have moderate levels of knowledge and confidence, but poor communication skills about HDS. Future curricula about HDS should target nurses, students, practitioners and those not currently using HDS. Research is needed to determine the most cost-effective educational strategies for diverse health professionals. [Abstract/Link to Full Text]

Vas J, Perea-Milla E, Mendez C, Silva LC, Herrera Galante A, Aranda Regules JM, Martinez Barquin DM, Aguilar I, Faus V
Efficacy and safety of acupuncture for the treatment of non-specific acute low back pain: a randomised controlled multicentre trial protocol [ISRCTN65814467].
BMC Complement Altern Med. 2006;614.
BACKGROUND: Low back pain and its associated incapacitating effects constitute an important healthcare and socioeconomic problem, as well as being one of the main causes of disability among adults of working age. The prevalence of non-specific low back pain is very high among the general population, and 60-70% of adults are believed to have suffered this problem at some time. Nevertheless, few randomised clinical trials have been made of the efficacy and efficiency of acupuncture with respect to acute low back pain. The present study is intended to assess the efficacy of acupuncture for acute low back pain in terms of the improvement reported on the Roland Morris Questionnaire (RMQ) on low back pain incapacity, to estimate the specific and non-specific effects produced by the technique, and to carry out a cost-effectiveness analysis. METHODS/DESIGN: Randomised four-branch controlled multicentre prospective study made to compare semi-standardised real acupuncture, sham acupuncture (acupuncture at non-specific points), placebo acupuncture and conventional treatment. The patients are blinded to the real, sham and placebo acupuncture treatments. Patients in the sample present symptoms of non specific acute low back pain, with a case history of 2 weeks or less, and will be selected from working-age patients, whether in paid employment or not, referred by General Practitioners from Primary Healthcare Clinics to the four clinics participating in this study. In order to assess the primary and secondary result measures, the patients will be requested to fill in a questionnaire before the randomisation and again at 3, 12 and 48 weeks after starting the treatment. The primary result measure will be the clinical relevant improvement (CRI) at 3 weeks after randomisation. We define CRI as a reduction of 35% or more in the RMQ results. DISCUSSION: This study is intended to obtain further evidence on the effectiveness of acupuncture on acute low back pain and to isolate the specific and non-specific effects of the treatment. [Abstract/Link to Full Text]

Miller MJ, Ahmed S, Bobrowski P, Haqqi TM
The chrondoprotective actions of a natural product are associated with the activation of IGF-1 production by human chondrocytes despite the presence of IL-1beta.
BMC Complement Altern Med. 2006;613.
BACKGROUND: Cartilage loss is a hallmark of arthritis and follows activation of catabolic processes concomitant with a disruption of anabolic pathways like insulin-like growth factor 1 (IGF-1). We hypothesized that two natural products of South American origin, would limit cartilage degradation by respectively suppressing catabolism and activating local IGF-1 anabolic pathways. One extract, derived from cat's claw (Uncaria guianensis, vincaria), is a well-described inhibitor of NF-kappaB. The other extract, derived from the vegetable Lepidium meyenii (RNI 249), possessed an uncertain mechanism of action but with defined ethnomedical applications for fertility and vitality. METHODS: Human cartilage samples were procured from surgical specimens with consent, and were evaluated either as explants or as primary chondrocytes prepared after enzymatic digestion of cartilage matrix. Assessments included IGF-1 gene expression, IGF-1 production (ELISA), cartilage matrix degradation and nitric oxide (NO) production, under basal conditions and in the presence of IL-1beta. RESULTS: RNI 249 enhanced basal IGF-1 mRNA levels in human chondrocytes by 2.7 fold, an effect that was further enhanced to 3.8 fold by co-administration with vincaria. Enhanced basal IGF-1 production by RNI 249 alone and together with vincaria, was confirmed in both explants and in primary chondrocytes (P < 0.05). As expected, IL-1beta exposure completely silenced IGF-1 production by chondrocytes. However, in the presence of IL-1beta both RNI 249 and vincaria protected IGF-1 production in an additive manner (P < 0.01) with the combination restoring chondrocyte IGF-1 production to normal levels. Cartilage NO production was dramatically enhanced by IL-1beta. Both vincaria and RNI 249 partially attenuated NO production in an additive manner (p < 0.05). IL-1beta - induced degradation of cartilage matrix was quantified as glycosaminoglycan release. Individually RNI 249 or vincaria, prevented this catabolic action of IL-1beta. CONCLUSION: The identification of agents that activate the autocrine production of IGF-1 in cartilage, even in the face of suppressive pro-inflammatory, catabolic cytokines like IL-1beta, represents a novel therapeutic approach to cartilage biology. Chondroprotection associated with prevention of the catabolic events and the potential for sustained anabolic activity with this natural product suggests that it holds significant promise in the treatment of debilitating joint diseases. [Abstract/Link to Full Text]

Nayak S, Nalabothu P, Sandiford S, Bhogadi V, Adogwa A
Evaluation of wound healing activity of Allamanda cathartica. L. and Laurus nobilis. L. extracts on rats.
BMC Complement Altern Med. 2006;612.
BACKGROUND: Allamanda cathartica. L. is a perennial shrub used in traditional medicine for treating malaria and jaundice. Laurus nobilis. L. is a tree and has been used for its astringent, healing and diuretic properties. The objective of this study was to investigate the aqueous extracts of Allamanda and Laurus nobilis to evaluate their wound healing activity in rats. METHODS: Excision and incision wound models were used to evaluate the wound healing activity of both the extracts on Sprague Dawley rats. In each model, animals were divided into four groups of 10 animals each. In both the model, group 1 served as control and group 2 as reference standard. In an excision wound model, group 3 animals were treated with Allamanda (150 mg kg(-1) day(-1)) and group 4 animals were treated with Laurus nobilis (200 mg kg(-1) b.w day(-1)) for 14 days respectively. In the case of incision wound model, group 3 and 4 animals were treated with the extracts of Allamanda and Laurus respectively for 10 days. The effects of vehicles on the rate of wound healing were assessed by the rate of wound closure, period of epithelialisation, tensile strength, weights of the granulation tissue, hydroxyproline content and histopathology of the granulation tissue. RESULTS: The aqueous extract of Allamanda promoted wound healing activity significantly in both the wound models studied. High rate of wound contraction (P < .001), decrease in the period of epithelialisation (10.2 +/- 0.13), high skin breaking strength (440.0 +/- 4.53), significant increase in the weight of the granulation tissue (P < .001) and hydroxyproline (P < .001) content were observed in animals treated with the aqueous extract of Allamanda. Histological studies of the granulation tissue from the Allamanda treated group showed the presence of a lesser number of inflammatory cells, and increased collagen formation than the control. In Laurus nobilis treated animals, the rate of wound contraction, weight of the granulation tissue and hydroxyproline content were moderately high (P < .05). The histological study of the granulation tissue of the Laurus nobilis treated animals showed larger number of inflammatory cells, and lesser collagen when compared with the Allamanda treated group of animals. However, it was better than the control group of animals. CONCLUSION: The data of this study indicated that the leaf extract of Allamanda possesses better wound healing activity than the Laurus nobilis and it can be used to treat different types of wounds in human beings too. [Abstract/Link to Full Text]

Runyoro DK, Matee MI, Ngassapa OD, Joseph CC, Mbwambo ZH
Screening of Tanzanian medicinal plants for anti-Candida activity.
BMC Complement Altern Med. 2006;611.
BACKGROUND: Candida albicans has become resistant to the already limited, toxic and expensive anti-Candida agents available in the market. These factors necessitate the search for new anti-fungal agents. METHODS: Sixty-three plant extracts, from 56 Tanzanian plant species obtained through the literature and interviews with traditional healers, were evaluated for anti-Candida activity. Aqueous methanolic extracts were screened for anti-Candida activity by bioautography agar overlay method, using a standard strain of Candida albicans (ATCC 90028). RESULTS: Twenty- seven (48%) out of the 56 plants were found to be active. Extracts of the root barks of Albizia anthelmintica and Balanites aegyptiaca, and roots of Plectranthus barbatus showed strong activity. CONCLUSION: The extracts that showed strong anti-Candida activity are worth of further investigation in order to isolate and identify the active compounds. [Abstract/Link to Full Text]

Shimoda H, Seki E, Aitani M
Inhibitory effect of green coffee bean extract on fat accumulation and body weight gain in mice.
BMC Complement Altern Med. 2006;69.
BACKGROUND: An epidemiological study conducted in Italy indicated that coffee has the greatest antioxidant capacity among the commonly consumed beverages. Green coffee bean is rich in chlorogenic acid and its related compounds. The effect of green coffee bean extract (GCBE) on fat accumulation and body weight in mice was assessed with the objective of investigating the effect of GCBE on mild obesity. METHODS: Male ddy mice were fed a standard diet containing GCBE and its principal constituents, namely, caffeine and chlorogenic acid, for 14 days. Further, hepatic triglyceride (TG) level was also investigated after consecutive administration (13 days) of GCBE and its constituents. To examine the effect of GCBE and its constituents on fat absorption, serum TG changes were evaluated in olive oil-loaded mice. In addition, to investigate the effect on hepatic TG metabolism, carnitine palmitoyltransferase (CPT) activity in mice was evaluated after consecutive ingestion (6 days) of GCBE and its constituents (caffeine, chlorogenic acid, neochlorogenic acid and feruloylquinic acid mixture). RESULTS: It was found that 0.5% and 1% GCBE reduced visceral fat content and body weight. Caffeine and chlorogenic acid showed a tendency to reduce visceral fat and body weight. Oral administration of GCBE (100 and 200 mg/kg. day) for 13 days showed a tendency to reduce hepatic TG in mice. In the same model, chlorogenic acid (60 mg/kg. day) reduced hepatic TG level. In mice loaded with olive oil (5 mL/kg), GCBE (200 and 400 mg/kg) and caffeine (20 and 40 mg/kg) reduced serum TG level. GCBE (1%), neochlorogenic acid (0.028% and 0.055%) and feruloylquinic acid mixture (0.081%) significantly enhanced hepatic CPT activity in mice. However, neither caffeine nor chlorogenic acid alone was found to enhance CPT activity. CONCLUSION: These results suggest that GCBE is possibly effective against weight gain and fat accumulation by inhibition of fat absorption and activation of fat metabolism in the liver. Caffeine was found to be a suppressor of fat absorption, while chlorogenic acid was found to be partially involved in the suppressive effect of GCBE that resulted in the reduction of hepatic TG level. Phenolic compounds such as neochlorogenic acid and feruloylquinic acid mixture, except chlorogenic acid, can enhance hepatic CPT activity. [Abstract/Link to Full Text]

Lao CD, Ruffin MT, Normolle D, Heath DD, Murray SI, Bailey JM, Boggs ME, Crowell J, Rock CL, Brenner DE
Dose escalation of a curcuminoid formulation.
BMC Complement Altern Med. 2006;610.
BACKGROUND: Curcumin is the major yellow pigment extracted from turmeric, a commonly-used spice in India and Southeast Asia that has broad anticarcinogenic and cancer chemopreventive potential. However, few systematic studies of curcumin's pharmacology and toxicology in humans have been performed. METHODS: A dose escalation study was conducted to determine the maximum tolerated dose and safety of a single dose of standardized powder extract, uniformly milled curcumin (C3 Complextrade mark, Sabinsa Corporation). Healthy volunteers were administered escalating doses from 500 to 12,000 mg. RESULTS: Seven of twenty-four subjects (30%) experienced only minimal toxicity that did not appear to be dose-related. No curcumin was detected in the serum of subjects administered 500, 1,000, 2,000, 4,000, 6,000 or 8,000 mg. Low levels of curcumin were detected in two subjects administered 10,000 or 12,000 mg. CONCLUSION: The tolerance of curcumin in high single oral doses appears to be excellent. Given that achieving systemic bioavailability of curcumin or its metabolites may not be essential for colorectal cancer chemoprevention, these findings warrant further investigation for its utility as a long-term chemopreventive agent. [Abstract/Link to Full Text]

Sundararajan R, Haja NA, Venkatesan K, Mukherjee K, Saha BP, Bandyopadhyay A, Mukherjee PK
Cytisus scoparius link--a natural antioxidant.
BMC Complement Altern Med. 2006;68.
BACKGROUND: Recent investigations have shown that the antioxidant properties of plants could be correlated with oxidative stress defense and different human diseases. In this respect flavonoids and other polyphenolic compounds have gained the greatest attention. The plant Cytisus scoparius contains the main constituent of flavone and flavonals. The present study was undertaken to evaluate the in vitro antioxidant activities of extract of aerial part of Cytisus scoparius. METHODS: The plant extract was tested for DPPH (1, 1-diphenyl, 2-picryl hydrazyl) radical scavenging, nitric oxide radical scavenging, superoxide anion radical scavenging, hydroxyl radical scavenging, antilipid peroxidation assay, reducing power and total phenol content. RESULTS: The extract exhibited scavenging potential with IC50 value of 1.5 microg/ml, 116.0 microg/ml and 4.7 microg/ml for DPPH, nitric oxide and superoxide anion radicals. The values were found to lesser than those of vitamin C, rutin, and curcumin, as standards. The extract showed 50% protection at the dose of 104.0 microg/ml in lipid peroxidation induced by Fe2+/ ascorbate system in rat liver microsomal preparation. There is decrease in hydroxyl radical generation with IC50 value of 27.0 microg/ml when compared with standard vitamin E. The reducing power of the extract depends on the amount of extract. A significant amount of polyphenols could be detected by the equivalent to 0.0589 microg of pyrocatechol from 1 mg of extract. CONCLUSION: The results obtained in the present study indicate that hydro alcoholic extract of aerial part of Cytisus scoparius is a potential source of natural antioxidants. [Abstract/Link to Full Text]

Paterson C
Measuring changes in self-concept: a qualitative evaluation of outcome questionnaires in people having acupuncture for their chronic health problems.
BMC Complement Altern Med. 2006;67.
BACKGROUND: Changes in self-concept are an important potential outcome for many interventions for people with long-term conditions. This study sought to identify and evaluate outcome questionnaires suitable for quantifying changes in self-concept in people with long-term conditions, in the context of treatment with acupuncture and Chinese medicine. METHODS: A literature search was followed by an evaluation of three questionnaires: The Wellbeing Questionnaire W-BQ12, the Patient Enablement Instrument (PEI), and the Arizona Integrative Outcome Scale (AIOS). A convenience sample of 23 people completed the questionnaires on two occasions and were interviewed about their experience and their questionnaire responses. All acupuncturists were interviewed. RESULTS: Changes in self-concept were common and emerged over time. The three questionnaires had different strengths and weaknesses in relation to measuring changes in self-concept. The generic AIOS had face validity and was sensitive to changes in self-concept over time, but it lacked specificity. The PEI was sensitive and specific in measuring these changes but had lower acceptability. The sensitivity of the W-BQ12 was affected by initial high scores (ceiling effect) and a shorter timescale but was acceptable and is suitable for repeated administration. The PEI and W-BQ12 questionnaires worked well in combination. CONCLUSION: Changes in self-concept are important outcomes of complex interventions for people with long-term illness and their measurement requires carefully evaluated tools and long-term follow-up. The literature review and the analysis of the strengths and weaknesses of the questionnaires is a resource for other researchers. The W-BQ12 and the PEI both proved useful for this population and a larger quantitative study is planned. [Abstract/Link to Full Text]

Ezz El-Arab AM, Girgis SM, Hegazy EM, Abd El-Khalek AB
Effect of dietary honey on intestinal microflora and toxicity of mycotoxins in mice.
BMC Complement Altern Med. 2006;66.
BACKGROUND: Bee honey is a functional food which has a unique composition, antimicrobial properties and bifidogenic effect. In order to assess whether honey can inhibit the toxic effect of mycotoxins, the present study was undertaken. METHODS: Production of biomass and toxins by Aspergillus parasiticus and Aspergillus ochraceus were followed in media without and with honey. Although aflatoxins and ochratoxin A. were administrated to male Swiss albino mice up to 1 mug and 10 ng/kg body weight/day respectively. The experimental animals were fed diets without our with 10% honey for two months. The changes in colonic probiotic bacteria, determintal colon enzyme glucuronidases, and genotoxicity were followed. RESULTS: Addition of 32% in its media increased the biomass of A parasiticus, while the biomass of A. ochraceus decreased and Ochratoxin A. was not produced. When the honey was added at the ratio of 32 and 48% in the medium. No relationship was found between mycelium weight and production of mycotoxins. Oral administration of aflatoxins (mixture of B1, B2, G1 and G2) and Ochratoxin A. induced structural and numerical chromosomal aberrations in bone marrow and germ cells of male mice, whereas, honey treatment reduced the genotoxicity of mycotoxins. Also both toxins induced histopathological changes in liver and kidney. Feeding on diet supplemented with honey improved the histopathological changes in case of aflatoxin group, but not in the case of ochratoxin A. group (except of kidney in two cases). No significant differences were found in the activity of colon beta-glucuronidase between group fed diet with or without honey. On the other hand, the colon bifido bacteria and lactobacilli counts were increased markedly in group receiving diet supplemented with honey. CONCLUSION: Substituting sugars with honey in processed food can inhibit the harmful and genotoxic effects of mycotoxins, and improve the gut microflora. [Abstract/Link to Full Text]

Greene BR, Smith M, Allareddy V, Haas M
Referral patterns and attitudes of primary care physicians towards chiropractors.
BMC Complement Altern Med. 2006;65.
BACKGROUND: Despite the increasing usage and popularity of chiropractic care, there has been limited research conducted to examine the professional relationships between conventional trained primary care physicians (PCPs) and chiropractors (DCs). The objectives of our study were to contrast the intra-professional referral patterns among PCPs with referral patterns to DCs, and to identify predictors of PCP referral to DCs. METHODS: We mailed a survey instrument to all practicing PCPs in the state of Iowa. Descriptive statistics were used to summarize their responses. Multivariable logistic regression analyses were conducted to identify demographic factors associated with inter-professional referral behaviors. RESULTS: A total of 517 PCPs (33%) participated in the study. PCPs enjoyed strong intra-professional referral relationships with other PCPs. Although patients exhibited a great deal of interest in chiropractic care, PCPs were unlikely themselves to make formal referral relationships with DCs. PCPs in a private practice arrangement were more likely to exhibit positive referral attitudes towards DCs (p = 0.01). CONCLUSION: PCPs enjoy very good professional relationships with other PCPs. However, the lack of direct formalized referral relationships between PCPs and chiropractors has implications for efficiency, continuity, quality, and patient safety in the health care delivery system. Future research must focus on identifying facilitators and barriers for developing positive relationships between PCPs and chiropractors. [Abstract/Link to Full Text]

Tai S, Wang J, Sun F, Xutian S, Wang T, King M
Effect of needle puncture and electro-acupuncture on mucociliary clearance in anesthetized quails.
BMC Complement Altern Med. 2006;64.
BACKGROUND: Acupuncture therapy for obstructive respiratory diseases has been effectively used in clinical practice and the acupuncture points or acupoints of Zhongfu and Tiantu are commonly-used acupoints to treat patients with the diseases. Since the impaired mucociliary clearance is among the most important features of airway inflammation in most obstructive respiratory diseases, the effect of needle puncture and electro-acupuncture at the specific acupoints on tracheal mucociliary clearance was investigated in anesthetized quails. METHODS: Mucociliary transport velocity on tracheal mucosa was measured through observing the optimal pathway, and fucose and protein contents in tracheal lavages were determined with biochemical methods. In the therapeutic group, needle puncture or electro-acupuncture stimulation to the acupoints was applied without or with constant current output in 2 mA and at frequency of 100 Hz for 60 minutes. In the sham group, electro-acupuncture stimulation to Liangmen was applied. RESULTS: Our present experiments demonstrated that the electro-acupuncture stimulation to Zhongfu and Tiantu significantly increased tracheal mucociliary transport velocity and decreased the content of protein in the tracheal lavage, compared with the control group. Moreover, either needle puncture or electro-acupuncture stimulation to Zhongfu and Tiantu significantly reverted the human neutrophil elastase-induced decrease in tracheal mucociliary transport velocity and human neutrophil elastase -induced increase in the contents of fucose and protein in the tracheal lavage, compared with the control group. CONCLUSION: These results suggest that either needle puncture or electro-acupuncture stimulation to the effective acupoints significantly improves both airway mucociliary clearance and the airway surface liquid and that the improvements maybe ascribed to both the special function of the points and the substantial stimulation of electricity. [Abstract/Link to Full Text]

Mohanty I, Arya DS, Gupta SK
Effect of Curcuma longa and Ocimum sanctum on myocardial apoptosis in experimentally induced myocardial ischemic-reperfusion injury.
BMC Complement Altern Med. 2006;63.
BACKGROUND: In the present investigation, the effect of Curcuma longa (Cl) and Ocimum sanctum (Os) on myocardial apoptosis and cardiac function was studied in an ischemia and reperfusion (I-R) model of myocardial injury. METHODS: Wistar albino rats were divided into four groups and orally fed saline once daily (sham, control IR) or Cl (100 mg/kg; Cl-IR) or Os (75 mg/kg; Os-IR) respectively for 1 month. On the 31st day, in the rats of the control IR, Cl-IR and Os-IR groups LAD occlusion was undertaken for 45 min, and reperfusion was allowed for 1 h. The hemodynamic parameters{mean arterial pressure (MAP), heart rate (HR), left ventricular end-diastolic pressure (LVEDP), left ventricular peak positive (+) LVdP/dt (rate of pressure development) and negative (-) LVdP/dt (rate of pressure decline)} were monitored at pre-set points throughout the experimental duration and subsequently, the animals were sacrificed for immunohistopathological (Bax, Bcl-2 protein expression & TUNEL positivity) and histopathological studies. RESULTS: Chronic treatment with Cl significantly reduced TUNEL positivity (p < 0.05), Bax protein (p < 0.001) and upregulated Bcl-2 (p < 0.001) expression in comparison to control IR group. In addition, Cl demonstrated mitigating effects on several myocardial injury induced hemodynamic {(+)LVdP/dt, (-) LVdP/dt & LVEDP} and histopathological perturbations. Chronic Os treatment resulted in modest modulation of the hemodynamic alterations (MAP, LVEDP) but failed to demonstrate any significant antiapoptotic effects and prevent the histopathological alterations as compared to control IR group. CONCLUSION: In the present study, significant cardioprotection and functional recovery demonstrated by Cl may be attributed to its anti-apoptotic property. In contrast to Os, Cl may attenuate cell death due to apoptosis and prevent the impairment of cardiac performance. [Abstract/Link to Full Text]

Rojas JJ, Ochoa VJ, Ocampo SA, Mu�oz JF
Screening for antimicrobial activity of ten medicinal plants used in Colombian folkloric medicine: a possible alternative in the treatment of non-nosocomial infections.
BMC Complement Altern Med. 2006;62.
BACKGROUND: The antimicrobial activity and Minimal Inhibitory Concentration (MIC) of the extracts of Bidens pilosa L., Bixa orellana L., Cecropia peltata L., Cinchona officinalis L., Gliricidia sepium H.B. & K, Jacaranda mimosifolia D.Don, Justicia secunda Vahl., Piper pulchrum C.DC, P. paniculata L. and Spilanthes americana Hieron were evaluated against five bacteria (Staphylococcus aureus, Streptococcus beta hemol�tic, Bacillus cereus, Pseudomonas aeruginosa, and Escherichia coli), and one yeast (Candida albicans). These plants are used in Colombian folk medicine to treat infections of microbial origin. METHODS: Plants were collected by farmers and traditional healers. The ethanol, hexane and water extracts were obtained by standard methods. The antimicrobial activity was found by using a modified agar well diffusion method. All microorganisms were obtained from the American Type Culture Collection (ATCC). MIC was determined in the plant extracts that showed some efficacy against the tested microorganisms. Gentamycin sulfate (1.0 microg/ml), clindamycin (0.3 microg/ml) and nystatin (1.0 microg/ml) were used as positive controls. RESULTS: The water extracts of Bidens pilosa L., Jacaranda mimosifolia D.Don, and Piper pulchrum C.DC showed a higher activity against Bacillus cereus and Escherichia coli than gentamycin sulfate. Similarly, the ethanol extracts of all species were active against Staphylococcus aureus except for Justicia secunda. Furthermore, Bixa orellana L, Justicia secunda Vahl. and Piper pulchrum C.DC presented the lowest MICs against Escherichia coli (0.8, 0.6 and 0.6 microg/ml, respectively) compared to gentamycin sulfate (0.9 8 g/ml). Likewise, Justicia secunda and Piper pulchrum C.DC showed an analogous MIC against Candida albicans (0.5 and 0.6 microg/ml, respectively) compared to nystatin (0.6 microg/ml). Bixa orellana L, exhibited a better MIC against Bacillus cereus (0.2 microg/ml) than gentamycin sulfate (0.5 microg/ml). CONCLUSION: This in vitro study corroborated the antimicrobial activity of the selected plants used in folkloric medicine. All these plants were effective against three or more of the pathogenic microorganisms. However, they were ineffective against Streptococcus beta hemolytic and Pseudomonas aeruginosa. Their medicinal use in infections associated with these two species is not recommended. This study also showed that Bixa orellana L, Justicia secunda Vahl. and Piper pulchrum C.DC could be potential sources of new antimicrobial agents. [Abstract/Link to Full Text]

Mani S, Lawson JW
In vitro modulation of inflammatory cytokine and IgG levels by extracts of Perna canaliculus.
BMC Complement Altern Med. 2006;61.
BACKGROUND: Inflammation is a predominant characteristic of autoimmune diseases which is characterized by the increased expression of pro-inflammatory cytokines. Soon to be published work from our laboratory has shown that ingestion of Perna canaliculus prevents the development of autoimmune diseases such as Systemic Lupus Erythematosus and rheumatoid arthritis in laboratory animals. The current paper attempts to illustrate how Perna can alleviate inflammation by modulating inflammatory cytokines, cyclooxygenase enzymes and Immunoglobulin-G (IgG) levels. METHODS: In the present study, hydrochloric acid [HCl] and Tween-20 were used to develop extracts of Perna. These extracts were assayed for protein content. Increasing concentrations of these extracts were then tested in cell culture for modulation of inflammatory cytokine, cyclooxygenase enzymes and IgG levels. Parallel tests were run using an available glycogen extract of Perna as a comparison to our in-house laboratory preparations. RESULTS: Tween-20 Perna extracts were found to be more stable and less toxic in cell culture than HCl digest of Perna. They also assayed higher in protein content that HCl extracts. Although both extracts inhibited IgG production in V2E9 hybridomas, Tween-20 extracts were more consistent in IgG suppression than HCl extracts. Overall Tween-20 extracts effectively decreased levels of TNF-alpha, IL-1, IL-2 and IL-6 as observed using cytokine bioassays. Twenty micrograms of Tween-20 Perna extracts induced such significant decreases in inflammatory cytokine production that when tested on sensitive cell lines, they very nearly abolished the decrease in viability induced by these cytokines. Tween-20 extracts effectively inhibited both COX-1 and COX-2 cyclooxygenase activity. As a comparison, the glycogen extract also demonstrated a similar though weaker effect on COX-1 and COX-2 enzymes. The active components of both extracts (Tween-20 and glycogen) were observed to possess molecular weights above 100 kDa. Although the anti-cytokine activity of the Tween-20 extract was destroyed by Proteinase-K treatment, the anti-COX-1 and anti-COX-2 activity of both the extracts were not sensitive to protease treatment. CONCLUSION: We have successfully demonstrated modulation in the levels of inflammatory cytokines, cyclooxygenase enzymes and immunoglobulins by our in-house laboratory preparations of Perna canaliculus, whereby suggesting an immunomodulatory role of Perna canaliculus in regulating inflammation. [Abstract/Link to Full Text]

Michalsen A, Riegert M, L�dtke R, B�cker M, Langhorst J, Schwickert M, Dobos GJ
Mediterranean diet or extended fasting's influence on changing the intestinal microflora, immunoglobulin A secretion and clinical outcome in patients with rheumatoid arthritis and fibromyalgia: an observational study.
BMC Complement Altern Med. 2005;522.
BACKGROUND: Alterations in the intestinal bacterial flora are believed to be contributing factors to many chronic inflammatory and degenerative diseases including rheumatic diseases. While microbiological fecal culture analysis is now increasingly used, little is known about the relationship of changes in intestinal flora, dietary patterns and clinical outcome in specific diseases. To clarify the role of microbiological culture analysis we aimed to evaluate whether in patients with rheumatoid arthritis (RA) or fibromyalgia (FM) a Mediterranean diet or an 8-day fasting period are associated with changes in fecal flora and whether changes in fecal flora are associated with clinical outcome. METHODS: During a two-months-period 51 consecutive patients from an Integrative Medicine hospital department with an established diagnosis of RA (n = 16) or FM (n = 35) were included in the study. According to predefined clinical criteria and the subjects' choice the patients received a mostly vegetarian Mediterranean diet (n = 21; mean age 50.9 +/-13.3 y) or participated in an intermittent modified 8-day fasting therapy (n = 30; mean age 53.7 +/- 9.4 y). Quantitative aerob and anaerob bacterial flora, stool pH and concentrations of secretory immunoglobulin A (sIgA) were analysed from stool samples at the beginning, at the end of the 2-week hospital stay and at a 3-months follow-up. Clinical outcome was assessed with the DAS 28 for RA patients and with a disease severity rating scale in FM patients. RESULTS: We found no significant changes in the fecal bacterial counts following the two dietary interventions within and between groups, nor were significant differences found in the analysis of sIgA and stool ph. Clinical improvement at the end of the hospital stay tended to be greater in fasting vs. non-fasting patients with RA (p = 0.09). Clinical outcome was not related to alterations in the intestinal flora. CONCLUSION: Neither Mediterranean diet nor fasting treatments affect the microbiologically assessed intestinal flora and sIgA levels in patients with RA and FM. The impact of dietary interventions on the human intestinal flora and the role of the fecal flora in rheumatic diseases have to be clarified with newer molecular analysis techniques. The potential benefit of fasting treatment in RA and FM should be further tested in randomised trials. [Abstract/Link to Full Text]

Watanabe E, Fukuda S, Shirakawa T
Effects among healthy subjects of the duration of regularly practicing a guided imagery program.
BMC Complement Altern Med. 2005;521.
BACKGROUND: We examined a large number of healthy adults in the general community who had individually participated in a guided imagery (GI) program daily and for various durations, to examine the psychophysiological effects of a GI program within a healthy group. METHODS: We studied 176 subjects who had participated in sessions that were part of a guided imagery program, and who had practiced GI at home for 20 minutes once daily in a quiet place after mastering GI in the group sessions. The average duration of GI practiced at home was 6.88 +/- 14.06 months (n = 138, range: 0 to 72). The Multiple Mood Scale (MMS), Betts (1909) Shortened Questionnaire on Mental Imagery (QMI), and a visual analog scale (VAS) of imagery vividness, salivary cortisol (CS) levels, general stress and general health were used in the sessions. RESULTS: We examined the relationship between the duration of daily GI practiced at home and MMS, QMI, CS, general health, and general stress at baseline. The subjects who had practiced GI at home longer had lower negative mood scores at baseline and lower severity of stress, and higher positive mood at baseline (both at a session and at home), general health, and QMI scores at baseline. The MMS change during a session and the duration of daily GI practiced at home were not correlated. Repeated-measures analysis of covariance showed that the duration of daily GI practiced as the covariate was not associated with changes in the three CS levels. CONCLUSION: Although regularly practicing a GI program daily for 20 min did not affect the CS level or mood during a GI session for several hours, it kept a good condition of the general mental, physical well-being and their overall stress of the practitioners as they had practiced it for long duration. We postulate that subjects who have the high ability of imaging vividness showed the better mood, health status and less stress than those subjects who have the low ability of it did. The ability of image vividness of the long-term regular practitioners of GI was higher than its short-term or inexperienced practitioners, which allowed practitioners to produce more comfortable imagery. Consequently, the longer the duration that they had practiced GI program once a day regularly, the lower scores of their stress were and the higher scores of their health were. We suggest that the regular daily practice of a GI program might be connected to less stress and better health. [Abstract/Link to Full Text]

Clement YN, Williams AF, Khan K, Bernard T, Bhola S, Fortun� M, Medupe O, Nagee K, Seaforth CE
A gap between acceptance and knowledge of herbal remedies by physicians: the need for educational intervention.
BMC Complement Altern Med. 2005;520.
BACKGROUND: The unprecedented global increase in the use of herbal remedies is set to continue apace well into the foreseeable future. This raises important public health concerns, especially as it relates to safety issues including adverse effects and herb-drug interactions. Most Western-trained physicians are ignorant of the risks and benefits of this healthcare modality and assessment of acceptance and knowledge would identify appropriate intervention strategies to improve physician-patient communication in this area. METHODS: A cross-sectional survey was done using an interviewer-administered pilot tested de novo questionnaire at six public hospitals in Trinidad between May-July 2004. The questionnaire utilized weighed questions to quantify acceptance (maximum score = 14 points) and knowledge (maximum score = 52 points). Acceptance and knowledge scores were analyzed using the ANOVA and Tukey's tests. RESULTS: Of 192 physicians interviewed, most (60.4%) believed that herbal remedies were beneficial to health. Respondents had relatively high acceptance levels (mean = 5.69 +/- 0.29 points or 40% of total possible score) and poor knowledge (mean = 7.77 +/- 0.56 points or 15% of total possible score). Seventy-eight physicians (40.6%) admitted having used herbs in the past, and 60 of these (76.9%) were satisfied with the outcome. Although 52 physicians (27.1%) recommended the use of herbs to their patients only 29 (15.1%) were able to identify at least one known herb-drug interaction. CONCLUSION: The use of herbal remedies is relatively high in Trinidad, as throughout the world, and most patients self-medicate with or without the knowledge of their attending physician. Surprisingly, we demonstrated relatively high acceptance levels and use of herbs among physicians in Trinidad. This interesting scenario of high acceptance levels and poor knowledge creates a situation that demands urgent intervention. We recommend educational intervention to narrow the gap between acceptance and knowledge so that physicians would be adequately equipped to communicate with their patients on this modality. The integration of herbal medicine into the curriculum of medical schools, continuing education programs and the availability of reputable pharmacopoeias for referencing at public health institutions are useful instruments that can be used to close this gap and promote improved physician-patient communication. [Abstract/Link to Full Text]

Vas J, Perea-Milla E, Mendez C, Galante AH, Madrazo F, Medina I, Ortega C, Olmo V, Fernandez FP, Hernandez L, Seminario JM, Brioso M, Luna F, Gordo I, Godoy AM, Jimenez C, Ruiz MA, Montes J, Hidalgo A, Gonzalez-Quevedo R, Bosch P, Vazquez A, Lozano JV
Acupuncture and rehabilitation of the painful shoulder: study protocol of an ongoing multicentre randomised controlled clinical trial [ISRCTN28687220].
BMC Complement Altern Med. 2005;519.
BACKGROUND: Although the painful shoulder is one of the most common dysfunctions of the locomotor apparatus, and is frequently treated both at primary healthcare centres and by specialists, little evidence has been reported to support or refute the effectiveness of the treatments most commonly applied. According to the bibliography reviewed, physiotherapy, which is the most common action taken to alleviate this problem, has not yet been proven to be effective, because of the small size of sample groups and the lack of methodological rigor in the papers published on the subject. No reviews have been made to assess the effectiveness of acupuncture in treating this complaint, but in recent years controlled randomised studies have been made and these demonstrate an increasing use of acupuncture to treat pathologies of the soft tissues of the shoulder. In this study, we seek to evaluate the effectiveness of physiotherapy applied jointly with acupuncture, compared with physiotherapy applied with a TENS-placebo, in the treatment of painful shoulder caused by subacromial syndrome (rotator cuff tendinitis and subacromial bursitis). METHODS/DESIGN: Randomised controlled multicentre study with blind evaluation by an independent observer and blind, independent analysis. A study will be made of 465 patients referred to the rehabilitation services at participating healthcare centres, belonging to the regional public health systems of Andalusia and Murcia, these patients presenting symptoms of painful shoulder and a diagnosis of subacromial syndrome (rotator cuff tendinitis and subacromial bursitis). The patients will be randomised into two groups: 1) experimental (acupuncture + physiotherapy); 2) control (TENS-placebo + physiotherapy); the administration of rescue medication will also be allowed. The treatment period will have a duration of three weeks. The main result variable will be the change produced on Constant's Shoulder Function Assessment (SFA) Scale; as secondary variables, we will record the changes in diurnal pain intensity on a visual analogue scale (VAS), nocturnal pain intensity on the VAS, doses of non-steroid anti-inflammatory drugs (NSAIDs) taken during the study period, credibility scale for the treatment, degree of improvement perceived by the patient and degree of improvement perceived by the evaluator. A follow up examination will be made at 3, 6 and 12 months after the study period has ended. Two types of population will be considered for analysis: per protocol and per intention to treat. DISCUSSION: The discussion will take into account the limitations of the study, together with considerations such as the choice of a simple, safe method to treat this shoulder complaint, the choice of the control group, and the blinding of the patients, evaluators and those responsible for carrying out the final analysis. [Abstract/Link to Full Text]

Sagar L, Sehgal R, Ojha S
Evaluation of antimotility effect of Lantana camara L. var. acuelata constituents on neostigmine induced gastrointestinal transit in mice.
BMC Complement Altern Med. 2005;518.
BACKGROUND: Lantana camara L. (Verbenaceae), a widely growing shrub which is toxic to some animal species, has been used in the traditional medicine for treating many ailments. The purpose of the present study was to evaluate the antimotility effects of Lantana camara leaf constituents in mice intestine. METHODS: Evaluation of antimotility activity was done in intestine of mice treated with Lantana camara leaf powder, Lantana camara methanolic extract (LCME), lantadene A, neostigmine and neostigmine + LCME. Neostigmine was used as a promotility agent. Intestinal motility was assessed by charcoal meal test and gastrointestinal transit rate was expressed as the percentage of the distance traversed by the charcoal divided by the total length of the small intestine. The antidiarrheal effect of LCME was studied against castor oil induced diarrhea model in mice. RESULTS: The intestinal transit with LCME at a dose of 500 mg/kg was 26.46% whereas the higher dose (1 g/kg) completely inhibited the transit of charcoal in normal mice. The % intestinal transit in the neostigmine pretreated groups was 24 and 11 at the same doses respectively. When the plant extracts at 125 and 250 mg/kg doses were administered intraperitonealy, there was significant reduction in fecal output compared with castor oil treated mice. At higher doses (500 and 1000 mg/kg), the fecal output was almost completely stopped. CONCLUSION: The remarkable antimotility effect of Lantana camara methanolic extract against neostigmine as promotility agent points towards an anticholinergic effect due to Lantana camara constituents and attests to its possible utility in secretory and functional diarrheas and other gastrointestinal disorders. This effect was further confirmed by significant inhibition of castor oil induced diarrhea in mice by various doses of LCME. [Abstract/Link to Full Text]

Paula FB, Gouv�a CM, Alfredo PP, Salgado I
Protective action of a hexane crude extract of Pterodon emarginatus fruits against oxidative and nitrosative stress induced by acute exercise in rats.
BMC Complement Altern Med. 2005;517.
BACKGROUND: The aim of the present work was to evaluate the effect of a hexane crude extract (HCE) of Pterodon emarginatus on the oxidative and nitrosative stress induced in skeletal muscle, liver and brain of acutely exercised rats. METHODS: Adult male rats were subjected to acute exercise by standardized contractions of the tibialis anterior (TA) muscle (100 Hz, 15 min) and treated orally with the HCE (once or three times with a fixed dose of 498 mg/kg), before and after acute exercise. Serum creatine kinase activity was determined by a kinetic method and macrophage infiltration by histological analyses of TA muscle. Lipid peroxidation was measured as malondialdehyde (MDA) levels. Nitric oxide production was evaluated by measuring nitrite formation, using Griess reagent, and nitrotyrosine was assessed by western blotting. RESULTS: Serum creatine kinase activities in the controls (111 U/L) increased 1 h after acute exercise (443 U/L). Acute exercise also increased the infiltration of macrophages into TA muscle; lipid peroxidation levels in TA muscle (967%), liver (55.5%) and brain (108.9%), as well as the nitrite levels by 90.5%, 30.7% and 60%, respectively. The pattern of nitrotyrosine formation was also affected by acute exercise. Treatment with HCE decreased macrophage infiltration, lipid peroxidation, nitrite production and nitrotyrosine levels to control values. CONCLUSION: Acute exercise induced by functional electrical stimulation in rats resulted in increase in lipid peroxidation, nitrite and nitrotyrosine levels in brain, liver and skeletal muscle. The exercise protocol, that involved eccentric muscle contraction, also caused some muscle trauma, associated with over-exertion, leading to inflammation. The extract of P. emarginatus abolished most of these oxidative processes, thus confirming the high antioxidant activity of this oil which infusions are used in folk medicine against inflammatory processes. [Abstract/Link to Full Text]

Tajuddin S, Latif A, Qasmi IA, Amin KM
An experimental study of sexual function improving effect of Myristica fragrans Houtt. (nutmeg).
BMC Complement Altern Med. 2005;516.
BACKGROUND: Myristica fragrans Houtt. (nutmeg) has been mentioned in Unani medicine to be of value in the management of male sexual disorders. The present study was undertaken to evaluate the aphrodisiac effect of 50% ethanolic extract of nutmeg along with its likely adverse effects and acute toxicity using various animal models. METHODS: The suspension of the extract was administered (100, 250 and 500 mg/kg, p.o.) to different groups of male rats daily for seven days. The female rats involved in mating were made receptive by hormonal treatment. The general mating behaviour, libido and potency were studied and compared with the standard reference drug sildenafil citrate. Likely adverse effects and acute toxicity of the extract were also evaluated. RESULTS: Oral administration of the extract at the dose of 500 mg/kg, produced significant augmentation of sexual activity in male rats. It significantly increased the Mounting Frequency, Intromission Frequency, Intromission Latency and caused significant reduction in the Mounting Latency and Post Ejaculatory Interval. It also significantly increased Mounting Frequency with penile anaesthetization as well as Erections, Quick Flips, Long Flips and the aggregate of penile reflexes with penile stimulation. The extract was also observed to be devoid of any adverse effects and acute toxicity. CONCLUSION: The resultant significant and sustained increase in the sexual activity of normal male rats without any conspicuous adverse effects indicates that the 50% ethanolic extract of nutmeg possesses aphrodisiac activity, increasing both libido and potency, which might be attributed to its nervous stimulating property. The present study thus provides a scientific rationale for the traditional use of nutmeg in the management of male sexual disorders. [Abstract/Link to Full Text]

Smith C, Martin K, Hotham E, Semple S, Bloustien G, Rao D
Naturopaths practice behaviour: provision and access to information on complementary and alternative medicines.
BMC Complement Altern Med. 2005;515.
BACKGROUND: The increasing use of complementary and alternative medicines in Australia has generated concern regarding the information on these products available to both healthcare providers and the public. The aim of this study was to examine the practice behaviours of naturopaths in relation to both the provision of and access to information on complementary and alternative medicines (CAM). METHODS: A representative sample of 300 practicing naturopaths located nationally were sent a comprehensive survey which gathered data on self reported practice behaviour in relation to the provision of information on oral CAM to clients and the information needs of the practitioners themselves. RESULTS: A response rate of 35% was achieved. Most practitioners (98%) have a dispensary within their clinic and the majority of practitioners perform the dispensing themselves. Practitioners reported they provided information to clients, usually in the form of verbal information (96%), handwritten notes (83%) and printed information (75%). The majority of practitioners (over 75%) reported always giving information on the full name of the product, reason for prescribing, expected response, possible interactions and contraindications and actions of the product. Information resources most often used by practitioners included professional newsletters, seminars run by manufacturers, patient feedback and personal observation of patients. Most practitioners were positive about the information they could access but felt that more information was required in areas such as adverse reactions and safe use of CAM in children, pregnancy and breastfeeding. Most naturopaths (over 96%) were informed about adverse events through manufacturer or distributor newsletters. The barriers in the provision of information to clients were misleading or incorrect information in the media, time constraints, information overload and complex language used in printed information. The main barrier to the practitioner in information access was seen as the perceived division between orthodox and complementary medicine practitioners. CONCLUSION: Our data suggest most naturopaths were concerned about possible interaction between pharmaceuticals and CAM, and explore this area with their patients. There is scope to improve practitioners' access to information of adverse events including an increased awareness of sources of information such as the Australian Therapeutic Goods Administration (TGA) website. [Abstract/Link to Full Text]

Saravanan R, Pari L
Antihyperlipidemic and antiperoxidative effect of Diasulin, a polyherbal formulation in alloxan induced hyperglycemic rats.
BMC Complement Altern Med. 2005;514.
BACKGROUND: This study was undertaken to investigation the effect of Diasulin, a poly herbal drug composed of ethanolic extract of ten medicinal plants on blood glucose, plasma insulin, tissue lipid profile, and lipidperoxidation in alloxan induced diabetes. METHODS: Ethanolic extract of Diasulin a, poly herbal drug was administered orally (200 mg/kg body weight) for 30 days. The different doses of Diasulin on blood glucose and plasma insulin in diabetic rats were studied and the levels of lipid peroxides [TBARS, and hydroperoxide] and tissue lipids [cholesterol, triglyceride, phospholipides and free fatty acids] were also estimated in alloxan induced diabetic rats. The effects were compared with glibenclamide. RESULT: Treatment with Diasulin and glibenclamide resulted in a significant reduction of blood glucose and increase in plasma insulin. Diasulin also resulted in a significant decrease in tissue lipids and lipid peroxide formation. The effect produced by Diasulin was comparable with that of glibenclamide. CONCLUSION: The decreased lipid peroxides and tissue lipids clearly showed the antihyperlipidemic and antiperoxidative effect of Diasulin apart from its antidiabetic effect. [Abstract/Link to Full Text]

Recent Articles in Evidence-based Complementary and Alternative Medicine

Wahner-Roedler DL, Vincent A, Elkin PL, Loehrer LL, Cha SS, Bauer BA
Physicians' attitudes toward complementary and alternative medicine and their knowledge of specific therapies: a survey at an academic medical center.
Evid Based Complement Alternat Med. 2006 Dec;3(4):495-501.
The purpose of this study was to evaluate the attitudes of physicians at an academic medical center toward complementary and alternative medicine (CAM) therapies and the physicians' knowledge base regarding common CAM therapies. A link to a Web-based survey was e-mailed to 660 internists at Mayo Clinic in Rochester, MN, USA. Physicians were asked about their attitudes toward CAM in general and their knowledge regarding specific CAM therapies. The level of evidence a physician would require before incorporating such therapies into clinical care was also assessed. Of the 233 physicians responding to the survey, 76% had never referred a patient to a CAM practitioner. However, 44% stated that they would refer a patient if a CAM practitioner were available at their institution. Fifty-seven percent of physicians thought that incorporating CAM therapies would have a positive effect on patient satisfaction, and 48% believed that offering CAM would attract more patients. Most physicians agreed that some CAM therapies hold promise for the treatment of symptoms or diseases, but most of them were not comfortable in counseling their patients about most CAM treatments. Prospective, randomized controlled trials were considered the level of evidence required for most physicians to consider incorporating a CAM therapy into their practice. The results of this survey provide insight into the attitudes of physicians toward CAM at an academic medical center. This study highlights the need for educational interventions and the importance of providing physicians ready access to evidence-based information regarding CAM. [Abstract/Link to Full Text]

Ucler S, Coskun O, Inan LE, Kanatli Y
Cold Therapy in Migraine Patients: Open-label, Non-controlled, Pilot Study.
Evid Based Complement Alternat Med. 2006 Dec;3(4):489-93.
Some patients with headache report that they have frequently used physical therapies such as application of cold to relieve their headache. There are only a few reported studies related to cold therapies in patients with migraine. In this study, we investigated the effect of cold application on migraine patients. Twenty-eight migraine patients were included. Cold therapy was administered to them by gel cap. Patients used this cap during their two migraine attacks. Before and after the cold therapy, headache severity was recorded by using visual analogue scale (VAS). Patients used this cap for 25 min in each application. They recorded their VAS score just after the therapy and 25 min, 1 h, 2 h and 3 h later. Two patients could not use this therapy due to side effects (one due to cold intolerance and one due to vertigo) in both applications. Therefore, therapeutic efficacy was evaluated in 26 patients. Twenty-five minutes after treatment of the first attack, VAS score was decreased from 7.89 +/- 1.93 to 5.54 +/- 2.96 (P < 0.01). Twenty-five minutes after treatment of the second attack, VAS score was decreased from 7.7 +/- 1.8 to 5.4 +/- 3.55 (P < 0.01). Cold application alone may be effective in some patients suffering from migraine attacks. Its combination with conventional drugs should be investigated in future studies. [Abstract/Link to Full Text]

Grassberger M, Hoch W
Ichthyotherapy as alternative treatment for patients with psoriasis: a pilot study.
Evid Based Complement Alternat Med. 2006 Dec;3(4):483-8.
Ichthyotherapy (therapy with the so-called 'Doctorfish of Kangal', Garra rufa) has been shown to be effective in patients with psoriasis in the Kangal hot springs in Turkey. This study evaluates the efficacy and safety of ichthyotherapy in combination with short-term ultraviolet A sunbed radiation in the treatment of psoriasis under controlled conditions. We retrospectively analyzed 67 patients diagnosed with psoriasis who underwent 3 weeks of ichthyotherapy at an outpatient treatment facility in Lower Austria between 2002 and 2004. Main outcome measures are as follows: overall relative reduction in Psoriasis Area Severity Index (PASI) score; proportion of patients with an improvement in their PASI score of >/=75% (PASI-75) and >/=50% (PASI-50); patient-reported outcomes assessed with a custom questionnaire; and patient follow-up with a questionnaire sent out in March 2005. Safety was evaluated by reviewing adverse events and vital signs. Overall there was a 71.7% reduction in PASI score compared to baseline (P < 0.0001). Of the 67 patients studied, 31 (46.3%) achieved PASI-75 and 61 patients (91%) achieved at least PASI-50. Patients reported substantial satisfaction with the treatment. The reported mean remission period was 8.58 months [95% confidence interval (CI) 6.05-11.11]. A total of 87.5% of patients reported a more favorable outcome with ichthyotherapy, when asked to compare ichthyotherapy to other previously tried therapies. Sixty-five percent stated that after the relapse their symptoms were less severe than before treatment. There were no significant adverse events. The benefit demonstrated in this study along with the favorable safety profile suggests that ichthyotherapy could provide a viable treatment option for patients with psoriasis. [Abstract/Link to Full Text]

Ohnishi ST, Ohnishi T, Nishino K
Ki-energy (life-energy) protects isolated rat liver mitochondria from oxidative injury.
Evid Based Complement Alternat Med. 2006 Dec;3(4):475-82.
We investigated whether 'Ki-energy' (life-energy) has beneficial effects on mitochondria. The paradigm we developed was to keep isolated rat liver mitochondria in conditions in which they undergo heat deterioration (39 degrees C for 10 min). After the heat treatment, the respiration of the mitochondria was measured using a Clarke-type oxygen electrode. Then, the respiratory control ratio (RC ratio; the ratio between State-3 and State-4 respiration, which is known to represent the integrity and intactness of isolated mitochondria) was calculated. Without the heat treatment, the RC ratio was >5 for NADH-linked respiration (with glutamate plus malate as substrates). The RC ratio decreased to 1.86-4.36 by the incubation at 39 degrees C for 10 min. However, when Ki-energy was applied by a Japanese Ki-expert during the heat treatment, the ratio was improved to 2.24-5.23. We used five preparations from five different rats, and the significance of the differences of each experiment was either P < 0.05 or P < 0.01 (n = 3-5). We analyzed the degree of lipid peroxidation in the mitochondria by measuring the amount of TBARS (thiobarbituric acid reactive substances). The amount of TBARS in heat-treated, no Ki-exposed mitochondria was greater than that of the control (no heat-treated, no Ki-exposed). However, the amount was reduced in the heat-treated, Ki-exposed mitochondria (two experiments; both P < 0.05) suggesting that Ki-energy protected mitochondria from oxidative stress. Calcium ions may play an important role in the protection by Ki-energy. Data also suggest that the observed Ki-effect involves, at least, near-infrared radiation (0.8-2.7 mum) from the human body. [Abstract/Link to Full Text]

Ranjbar A, Khorami S, Safarabadi M, Shahmoradi A, Malekirad AA, Vakilian K, Mandegary A, Abdollahi M
Antioxidant Activity of Iranian Echium amoenum Fisch & C.A. Mey Flower Decoction in Humans: A cross-sectional Before/After Clinical Trial.
Evid Based Complement Alternat Med. 2006 Dec;3(4):469-73.
Medicinal plants are recognized as sources of natural antioxidants that can protect from biological system oxidative stress. The present cross-sectional before/after clinical trial was carried out to investigate the antioxidant properties of the decoction of the flowers of Echium amoenum Fisch & C.A. Mey in humans. A group of 38 healthy subjects was invited to use the E. amoenum (7 mg kg(-1)) twice daily for 14 days. Blood samples before and after entering the study were measured for lipid peroxidation level (LPO), total antioxidant capacity (TAC) and total thiol (SH) molecules. A significant reduction of blood LPO (24.65 +/- 11.3 versus 19.05 +/- 9.7, P = 0.029) was observed after 14 days of E. amoenum consumption. Blood TAC (1.46 +/- 0.51 versus 1.70 +/- 0.36, P = 0.018) and total thiol molecules (0.49 +/- 0.11 versus 0.56 +/- 0.12, P = 0.001) increased after 14 days of E. amoenum consumption. In conclusion, this antioxidative stress potential of E. amoenum may be due to its bioactive antioxidant components, especially rosmarinic acid and flavonoids. In recent years the importance of oxidative stress in the pathophysiology of many human disorders has been confirmed, thus use of this plant as a dietary supplement is highly recommended. [Abstract/Link to Full Text]

Kiyohara H, Nagai T, Munakata K, Nonaka K, Hanawa T, Kim SJ, Yamada H
Stimulating effect of Japanese herbal (kampo) medicine, hochuekkito on upper respiratory mucosal immune system.
Evid Based Complement Alternat Med. 2006 Dec;3(4):459-67.
Japanese herbal (Kampo) medicine, Hochuekkito (Bu-Zhong-Yi-Qi-Tang in Chinese, TJ-41) and Juzentaihoto (Shi-Quan-Da-Bu-Tang in Chinese, TJ-48) are well-known Kampo formulas used as tonic. Although these medicines have separately been applied to the patients clinically depending on their symptoms, the differences of the pharmacological activities for these medicines have not been fully understood. TJ-48 and TJ-41 were compared for their effects on antibody response in upper respiratory mucosal immune system in vivo. Oral administration of TJ-41 (100 mg kg(-1) per day) to early aged BALB/c mice, which were nasally sensitized with influenza hemagglutinin vaccine, significantly enhanced influenza virus-specific IgA and IgG antibody titers in nasal cavity and sera, respectively. However, oral administration of TJ-48 (100 mg kg(-1) per day) failed to show the enhancing activity. TJ-41 increased not only influenza virus-specific IgA antibody titer but also total IgA antibody titer in nasal cavity. The stimulating activity of TJ-41 disappeared after treatment with methotrexate. The present study strongly suggests that TJ-41 can stimulate the mucosal immune system of upper respiratory tract, and results in enhancement of antigen-specific antibody response in upper respiratory mucosal and systemic immune systems. [Abstract/Link to Full Text]

Chavan P, Joshi K, Patwardhan B
DNA microarrays in herbal drug research.
Evid Based Complement Alternat Med. 2006 Dec;3(4):447-57.
Natural products are gaining increased applications in drug discovery and development. Being chemically diverse they are able to modulate several targets simultaneously in a complex system. Analysis of gene expression becomes necessary for better understanding of molecular mechanisms. Conventional strategies for expression profiling are optimized for single gene analysis. DNA microarrays serve as suitable high throughput tool for simultaneous analysis of multiple genes. Major practical applicability of DNA microarrays remains in DNA mutation and polymorphism analysis. This review highlights applications of DNA microarrays in pharmacodynamics, pharmacogenomics, toxicogenomics and quality control of herbal drugs and extracts. [Abstract/Link to Full Text]

Dos Santos-Neto LL, de Vilhena Toledo MA, Medeiros-Souza P, de Souza GA
The use of herbal medicine in Alzheimer's disease-a systematic review.
Evid Based Complement Alternat Med. 2006 Dec;3(4):441-5.
The treatments of choice in Alzheimer's disease (AD) are cholinesterase inhibitors and NMDA-receptor antagonists, although doubts remain about the therapeutic effectiveness of these drugs. Herbal medicine products have been used in the treatment of Behavioral and Psychological Symptoms of Dementia (BPSD) but with various responses. The objective of this article was to review evidences from controlled studies in order to determine whether herbs can be useful in the treatment of cognitive disorders in the elderly. Randomized controlled studies assessing AD in individuals older than 65 years were identified through searches of MEDLINE, LILACS, Cochrane Library, dissertation Abstract (USA), ADEAR (Alzheimer's Disease Clinical Trials Database), National Research Register, Current Controlled trials, Centerwatch Trials Database and PsychINFO Journal Articles. The search combined the terms Alzheimer disease, dementia, cognition disorders, Herbal, Phytotherapy. The crossover results were evaluated by the Jadad's measurement scale. The systematic review identified two herbs and herbal formulations with therapeutic effects for the treatment of AD: Melissa officinalis, Salvia officinalis and Yi-Gan San and BDW (Ba Wei Di Huang Wan). Ginkgo biloba was identified in a meta-analysis study. All five herbs are useful for cognitive impairment of AD. M. officinalis and Yi-Gan San are also useful in agitation, for they have sedative effects. These herbs and formulations have demonstrated good therapeutic effectiveness but these results need to be compared with those of traditional drugs. Further large multicenter studies should be conducted in order to test the cost-effectiveness of these herbs for AD and the impact in the control of cognitive deterioration. [Abstract/Link to Full Text]

Saad B, Azaizeh H, Abu-Hijleh G, Said O
Safety of traditional arab herbal medicine.
Evid Based Complement Alternat Med. 2006 Dec;3(4):433-9.
Herbal remedies are widely used for the treatment and prevention of various diseases and often contain highly active pharmacological compounds. Many medicinal herbs and pharmaceutical drugs are therapeutic at one dose and toxic at another. Toxicity related to traditional medicines is becoming more widely recognized as these remedies become popular in the Mediterranean region as well as worldwide. Most reports concerning the toxic effects of herbal medicines are associated with hepatotoxicity although reports of other toxic effects including kidney, nervous system, blood, cardiovascular and dermatologic effects, mutagenicity and carcinogenicity have also been published in the medical literature. This article presents a systematic review on safety of traditional Arab medicine and the contribution of Arab scholars to toxicology. Use of modern cell biological, biochemical, in vitro and in vivo techniques for the evaluation of medicinal plants safety is also discussed. [Abstract/Link to Full Text]

Canter PH, Coon JT, Ernst E
Cost-effectiveness of complementary therapies in the United kingdom-a systematic review.
Evid Based Complement Alternat Med. 2006 Dec;3(4):425-32.
Objectives: The aim of this review is to systematically summarize and assess all prospective, controlled, cost-effectiveness studies of complementary therapies carried out in the UK. Data sources: Medline (via PubMed), Embase, CINAHL, Amed (Alternative and Allied Medicine Database, British Library Medical Information Centre), The Cochrane Library, National Health Service Economic Evaluation Database (via Cochrane) and Health Technology Assessments up to October 2005. Review methods: Articles describing prospective, controlled, cost-effectiveness studies of any type of complementary therapy for any medical condition carried out in the UK were included. Data extracted included the main outcomes for health benefit and cost. These data were extracted independently by two authors, described narratively and also presented as a table. Results: Six cost-effectiveness studies of complementary medicine in the UK were identified: four different types of spinal manipulation for back pain, one type of acupuncture for chronic headache and one type of acupuncture for chronic back pain. Four of the six studies compared the complementary therapy with usual conventional treatment in pragmatic, randomized clinical trials without sham or placebo arms. Main outcome measures of effectiveness favored the complementary therapies but in the case of spinal manipulation (four studies) and acupuncture (one study) for back pain, effect sizes were small and of uncertain clinical relevance. The same four studies included a cost-utility analyses in which the incremental cost per quality adjusted life year (QALY) was less than pound10 000. The complementary therapy represented an additional health care cost in five of the six studies. Conclusions: Prospective, controlled, cost-effectiveness studies of complementary therapies have been carried out in the UK only for spinal manipulation (four studies) and acupuncture (two studies). The limited data available indicate that the use of these therapies usually represents an additional cost to conventional treatment. Estimates of the incremental cost of achieving improvements in quality of life compare favorably with other treatments approved for use in the National Health Service. Because the specific efficacy of the complementary therapies for these indications remains uncertain, and the studies did not include sham controls, the estimates obtained may represent the cost-effectiveness non-specific effects associated with the complementary therapies. [Abstract/Link to Full Text]

Chiappelli F, Navarro AM, Moradi DR, Manfrini E, Prolo P
Evidence-Based Research in Complementary and Alternative Medicine III: Treatment of Patients with Alzheimer's Disease.
Evid Based Complement Alternat Med. 2006 Dec;3(4):411-24.
This paper presents the novel domain of evidence-based research (EBR) in the treatment of patients with Alzheimer's disease (AD) from the perspective of traditional medicine and of complementary and alternative medicine. In earlier lectures we have described the process of evidence-based medicine as a methodological approach to clinical practice that is directed to aid clinical decision-making. Here, we present a practical example of this approach with respect to traditional pharmacological interventions and to complementary and alternative treatments for patients with AD. [Abstract/Link to Full Text]

Bellavite P, Ortolani R, Pontarollo F, Piasere V, Benato G, Conforti A
Immunology and homeopathy. 4. Clinical studies-part 2.
Evid Based Complement Alternat Med. 2006 Dec;3(4):397-409.
The clinical studies on the effectiveness of homeopathy in respiratory allergy (18 randomized trials and 9 observational studies) are described. The literature of common immunologic disorders including also upper respiratory tract infections (URTI) and otorhinolaryngology (reported in part 1), is evaluated and discussed. Most of initial evidence-based research was addressed to the question of whether homeopathic high dilutions are placebos or possess specific effects, but this question has been often equivocal and is still a matter of debate. The evidence demonstrates that in some conditions homeopathy shows significant promise, e.g. Galphimia glauca (low dilutions/potencies) in allergic oculorhinitis, classical individualized homeopathy in otitis and possibly in asthma and allergic complaints, and a few low-potency homeopathic complexes in sinusitis and rhinoconjunctivitis. A general weakness of evidence derives from lack of independent confirmation of reported trials and from presence of conflicting results, as in case of homeopathic immunotherapy and of classical homeopathy for URTI. The suitable methods to evaluate homeopathy effectiveness, without altering the setting of cure, are also analyzed. [Abstract/Link to Full Text]

Cooper EL
eCAM: On To Year 4.
Evid Based Complement Alternat Med. 2006 Dec;3(4):395-6. [Abstract/Link to Full Text]

Caprilli S, Messeri A
Animal-Assisted Activity at A. Meyer Children's Hospital: A Pilot Study.
Evid Based Complement Alternat Med. 2006 Sep;3(3):379-83.
The authors systematically studied the introduction of animal-assisted activity into a children's hospital in Italy. This pilot study examined the reactions of children, their parents and the hospital staff and the hospital-wide infection rate before and after the introduction of animals. The SAM (self-assessment manikin), three behavioral scales, analysis of children's graphic productions, a parent questionnaire and a staff questionnaire were used to evaluate the effectiveness of the intervention. The children's participation was calculated. The analysis of the hospital infection rate was completed independently by the Hospital Infections Committee. The authors found that the presence of infections in the wards did not increase and the number of children at the meetings with pets in the wards was high (138 children). The study also found that the presence of animals produced some beneficial effects on children: a better perception of the environment and a good interaction with dogs. All parents were in favor of pets in the hospital, and 94% thought that this activity could benefit the child, as did the medical staff, although the staff needed more information about safety. The introduction of pets into the pediatric wards in an Italian children's hospital was a positive event because of the participation of hospitalized patients, the satisfaction expressed by both parents and medical staff, and the fact that the hospital infection rate did not change and no new infections developed after the introduction of dogs. [Abstract/Link to Full Text]

Williams TI
Evaluating effects of aromatherapy massage on sleep in children with autism: a pilot study.
Evid Based Complement Alternat Med. 2006 Sep;3(3):373-7.
Previous studies have found beneficial effects of aromatherapy massage for agitation in people with dementia, for pain relief and for poor sleep. Children with autism often have sleep difficulties, and it was thought that aromatherapy massage might enable more rapid sleep onset, less sleep disruption and longer sleep duration. Twelve children with autism and learning difficulties (2 girls and 10 boys aged between 12 years 2 months to 15 years 7 months) in a residential school participated in a within subjects repeated measures design: 3 nights when the children were given aromatherapy massage with lavender oil were compared with 14 nights when it was not given. The children were checked every 30 min throughout the night to determine the time taken for the children to settle to sleep, the number of awakenings and the sleep duration. One boy's data were not analyzed owing to lengthy absence. Repeated measures analysis revealed no differences in any of the sleep measures between the nights when the children were given aromatherapy massage and nights when the children were not given aromatherapy massage. The results suggest that the use of aromatherapy massage with lavender oil has no beneficial effect on the sleep patterns of children with autism attending a residential school. It is possible that there are greater effects in the home environment or with longer-term interventions. [Abstract/Link to Full Text]

Luo JZ, Luo L
American Ginseng Stimulates Insulin Production and Prevents Apoptosis through Regulation of Uncoupling Protein-2 in Cultured beta Cells.
Evid Based Complement Alternat Med. 2006 Sep;3(3):365-72.
American ginseng root displays the ability to achieve glucose homeostasis both experimentally and clinically but the unknown mechanism used by ginseng to achieve its therapeutic effects on diabetes limits its application. Disruption in the insulin secretion of pancreatic beta cells is considered the major cause of diabetes. A mitochondrial protein, uncoupling protein-2 (UCP-2) has been found to play a critical role in insulin synthesis and beta cell survival. Our preliminary studies found that the extracts of American ginseng inhibit UCP-2 expression which may contribute to the ability of ginseng protecting beta cell death and improving insulin synthesis. Therefore, we hypothesized that ginseng extracts suppress UCP-2 in the mitochondria of pancreatic beta cells, promoting insulin synthesis and anti-apoptosis (a programmed cell-death mechanism). To test the hypothesis, the serum-deprived quiescent beta cells were cultured with or without interleukin-1beta (IL-1beta), (200 pg ml(-1), a cytokine to induce beta cell apoptosis) and water extracts of American ginseng (25 mug per 5 mul administered to wells of 0.5 ml culture) for 24 h. We evaluated effects of ginseng on UCP-2 expression, insulin production, anti-/pro-apoptotic factors Bcl-2/caspase-9 expression and cellular ATP levels. We found that ginseng suppresses UCP-2, down-regulates caspase-9 while increasing ATP and insulin production/secretion and up-regulates Bcl-2, reducing apoptosis. These findings suggest that stimulation of insulin production and prevention of beta cell loss by American ginseng extracts can occur via the inhibition of mitochondrial UCP-2, resulting in increase in the ATP level and the anti-apoptotic factor Bcl-2, while down-regulation of pro-apoptotic factor caspase-9 occurs, lowering the occurrence of apoptosis, which support the hypothesis. [Abstract/Link to Full Text]

Nozaki K, Hikiami H, Goto H, Nakagawa T, Shibahara N, Shimada Y
Keishibukuryogan (gui-zhi-fu-ling-wan), a kampo formula, decreases disease activity and soluble vascular adhesion molecule-1 in patients with rheumatoid arthritis.
Evid Based Complement Alternat Med. 2006 Sep;3(3):359-64.
An increasing death rate due to cardiovascular disease in patients with rheumatoid arthritis (RA) has been reported. Keishibukuryogan (KBG) is a traditional Chinese/Japanese (Kampo) formula that has been administered to patients with blood stagnation, e.g. thrombotic disease and atherosclerosis. The objective of this study was to evaluate the efficacy of KBG on disease activity and endothelial dysfunction in RA patients. Sixteen RA patients were enrolled and administered KBG (12 g per day) for 12 weeks in addition to continuing other drugs. The disease activity of RA was assessed by modified disease activity scores for 28 joints (DAS(28)). Plasma levels of adhesion molecules, soluble E-selectin (sE-selectin), soluble intercellular adhesion molecule-1 (sICAM-1) and soluble vascular cell adhesion molecule-1 (sVCAM-1) were evaluated. C-reactive protein (CRP), inflammatory cytokines (IL-1beta, IL-6 and TNF-alpha) and lipid peroxide (LPO) were also evaluated. Fourteen patients completed the study. The disease activity of RA, tender joint count, swollen joint count and DAS(28) decreased significantly. Among adhesion molecules, only sVCAM-1 decreased significantly. LPO also decreased significantly, whereas CRP and inflammatory cytokines remained unchanged. These results suggest that KBG has insufficient anti-inflammatory or immunomodulating effect but does have a beneficial effect on articular symptoms and a protective effect against endothelial dysfunction in RA patients. [Abstract/Link to Full Text]

Mohandas Rao KG, Muddanna Rao S, Gurumadhva Rao S
Centella asiatica (L.) Leaf Extract Treatment During the Growth Spurt Period Enhances Hippocampal CA3 Neuronal Dendritic Arborization in Rats.
Evid Based Complement Alternat Med. 2006 Sep;3(3):349-57.
Centella asiatica (CeA) is a creeping plant growing in damp places in India and other Asian countries. The leaves of CeA are used for memory enhancement in the Ayurvedic system of medicine, an alternative system of medicine in India. In this study, we have investigated the effect during the rat growth spurt period of CeA fresh leaf extract treatment on the dendritic morphology of hippocampal CA3 neurons, one of the regions of the brain concerned with learning and memory. Neonatal rat pups (7 days old) were fed with 2, 4 or 6 ml kg(-1) body weight of fresh leaf extract of CeA for 2, 4 or 6 weeks. After the treatment period the rats were killed, their brains were removed and the hippocampal neurons were impregnated with silver nitrate (Golgi staining). Hippocampal CA3 neurons were traced using a camera lucida, and dendritic branching points (a measure of dendritic arborization) and intersections (a measure of dendritic length) were quantified. These data were compared with data for age-matched control rats. The results showed a significant increase in the dendritic length (intersections) and dendritic branching points along the length of both apical and basal dendrites in rats treated with 4 and 6 ml kg(-1) body weight per day of CeA for longer periods of time (i.e. 4 and 6 weeks). We conclude that the constituents/active principles present in CeA fresh leaf extract have a neuronal dendritic growth stimulating property; hence, the extract can be used for enhancing neuronal dendrites in stress and neurodegenerative and memory disorders. [Abstract/Link to Full Text]

Hidaka S, Okamoto Y, Uchiyama S, Nakatsuma A, Hashimoto K, Ohnishi ST, Yamaguchi M
Royal jelly prevents osteoporosis in rats: beneficial effects in ovariectomy model and in bone tissue culture model.
Evid Based Complement Alternat Med. 2006 Sep;3(3):339-48.
Royal jelly (RJ) has been used worldwide for many years as medical products, health foods and cosmetics. Since RJ contains testosterone and has steroid hormone-type activities, we hypothesized that it may have beneficial effects on osteoporosis. We used both an ovariectomized rat model and a tissue culture model. Rats were divided into eight groups as follows: sham-operated (Sham), ovariectomized (OVX), OVX given 0.5% (w/w) raw RJ, OVX given 2.0% (w/w) RJ, OVX given 0.5% (w/w) protease-treated RJ (pRJ), OVX given 2.0% (w/w) pRJ, OVX given 17beta-estradiol and OVX given its vehicle, respectively. The Ovariectomy decreased tibial bone mineral density (BMD) by 24%. Administration of 17beta-estradiol to OVX rats recovered the tibial BMD decrease by 100%. Administration of 2.0% (w/w) RJ and 0.5-2.0% (w/w) pRJ to OVX rats recovered it by 85% or more. These results indicate that both RJ and pRJ are almost as effective as 17beta-estradiol in preventing the development of bone loss induced by ovariectomy in rats. In tissue culture models, both RJ and pRJ increased calcium contents in femoral-diaphyseal and femoral-metaphyseal tissue cultures obtained from normal male rats. However, in a mouse marrow culture model, they neither inhibited the parathyroid hormone (PTH)-induced calcium loss nor affected the formation of osteoclast-like cells induced by PTH in mouse marrow culture system. Therefore, our results suggest that both RJ and pRJ may prevent osteoporosis by enhancing intestinal calcium absorption, but not by directly antagonizing the action of PTH. [Abstract/Link to Full Text]

Ljubuncic P, Dakwar S, Portnaya I, Cogan U, Azaizeh H, Bomzon A
Aqueous Extracts of Teucrium polium Possess Remarkable Antioxidant Activity In Vitro.
Evid Based Complement Alternat Med. 2006 Sep;3(3):329-38.
Teucrium polium L. (Lamiaceae) (RDC 1117) is a medicinal plant whose species have been used for over 2000 years in traditional medicine due to its diuretic, diaphoretic, tonic, antipyretic, antispasmodic and cholagogic properties. The therapeutic benefit of medicinal plants is often attributed to their antioxidant properties. We previously reported that an aqueous extract of the leaves and stems of this plant could inhibit iron-induced lipid peroxidation in rat liver homogenate at concentrations that were not toxic to cultured hepatic cells. Others have reported that organic extracts of the aerial components of this plant could inhibit oxidative processes. Against this background, we felt further investigation on the antioxidant action of the extract of T. polium prepared according to traditional Arab medicine was warranted. Accordingly, we assessed (i) its ability to inhibit (a) oxidation of beta-carotene, (b) 2,2'-azobis(2-amidinopropan) dihydrochloride (AAPH)-induced plasma oxidation and (c) iron-induced lipid peroxidation in rat liver homogenates; (ii) to scavenge the superoxide (O2*-) radical and the hydroxyl radical (OH(*)); (iii) its effects on the enzyme xanthine oxidase activity; (iv) its capacity to bind iron; and (v) its effect on cell glutathione (GSH) homeostasis in cultured Hep G2 cells. We found that the extract (i) inhibited (a) oxidation of beta-carotene, (b) AAPH-induced plasma oxidation (c) Fe(2+)-induced lipid peroxidation in rat liver homogenates (IC(50) = 7 +/- 2 mug ml(-1)); (ii) scavenged O2*-(IC(50) = 12 +/- 3 mug ml(-1)) and OH(*) (IC(50) = 66 +/- 20 mug ml(-1)); (iii) binds iron (IC(50) = 79 +/- 17 mug ml(-1)); and (iv) tended to increase intracellular GSH levels resulting in a decrease in the GSSG/GSH ratio. These results demonstrate that the extract prepared from the T. polium possesses antioxidant activity in vitro. Further investigations are needed to verify whether this antioxidant effect occurs in vivo. [Abstract/Link to Full Text]

Samane S, No�l J, Charrouf Z, Amarouch H, Haddad PS
Insulin-sensitizing and Anti-proliferative Effects of Argania spinosa Seed Extracts.
Evid Based Complement Alternat Med. 2006 Sep;3(3):317-27.
Argania spinosa is an evergreen tree endemic of southwestern Morocco. Many preparations have been used in traditional Moroccan medicine for centuries to treat several illnesses including diabetes. However, scientific evidence supporting these actions is lacking. Therefore, we prepared various extracts of the argan fruit, namely keel, cake and argan oil extracts, which we tested in the HTC hepatoma cell line for their potential to affect cellular insulin responses. Cell viability was measured by Trypan Blue exclusion and the response to insulin evaluated by the activation of the extracellular regulated kinase (ERK1/2), ERK kinase (MEK1/2) and protein kinase B (PKB/Akt) signaling components. None of the extracts demonstrated significant cytotoxic activity. Certain extracts demonstrated a bi-phasic effect on ERK1/2 activation; low doses of the extract slightly increased ERK1/2 activation in response to insulin, whereas higher doses completely abolished the response. In contrast, none of the extracts had any significant effect on MEK whereas only a cake saponin subfraction enhanced insulin-induced PKB/Akt activation. The specific action of argan oil extracts on ERK1/2 activation made us consider an anti-proliferative action. We have thus tested other transformed cell lines (HT-1080 and MSV-MDCK-INV cells) and found similar results. Inhibition of ERK1/2 activation was also associated with decreased DNA synthesis as evidenced by [(3)H]thymidine incorporation experiments. These results suggest that the products of Argania spinosa may provide a new therapeutic avenue against proliferative diseases. [Abstract/Link to Full Text]

Vojdani A, Erde J
Regulatory T Cells, a Potent Immunoregulatory Target for CAM Researchers: Modulating Tumor Immunity, Autoimmunity and Alloreactive Immunity (III).
Evid Based Complement Alternat Med. 2006 Sep;3(3):309-16.
Regulatory T (T(reg)) cells are the major arbiter of immune responses, mediating actions through the suppression of inflammatory and destructive immune reactions. Inappropriate T(reg) cell frequency or functionality potentiates the pathogenesis of myriad diseases with ranging magnitudes of severity. Lack of suppressive capability hinders restraint on immune responses involved in autoimmunity and alloreactivity, while excessive suppressive capacity effectively blocks processes necessary for tumor destruction. Although the etiology of dysfunctional T(reg) cell populations is under debate, the ramifications, and their mechanisms, are increasingly brought to light in the medical community. Methods that compensate for aberrant immune regulation may not address the underlying complications; however, they hold promise for the alleviation of debilitating immune system-related disorders. The dominant immunoregulatory nature of T(reg) cells, coupled with recent mechanistic knowledge of natural immunomodulatory compounds, highlights the importance of T(reg) cells to practitioners and researchers of complementary and alternative medicine (CAM). [Abstract/Link to Full Text]

Nigam Y, Bexfield A, Thomas S, Ratcliffe NA
Maggot Therapy: The Science and Implication for CAM Part II-Maggots Combat Infection.
Evid Based Complement Alternat Med. 2006 Sep;3(3):303-8.
Maggot therapy employs the use of freshly emerged, sterile larvae of the common green-bottle fly, Phaenicia (Lucilia) sericata, and is a form of artificially induced myiasis in a controlled clinical situation. Maggot therapy has the following three core beneficial effects on a wound: debridement, disinfection and enhanced healing. In part II of this review article, we discuss clinical infections and the evidence supporting the potent antibacterial action of maggot secretions. Enhancement of wound healing by maggots is discussed along with the future of this highly successful, often controversial, alternative treatment. [Abstract/Link to Full Text]

Bellavite P, Ortolani R, Pontarollo F, Piasere V, Benato G, Conforti A
Immunology and homeopathy. 4. Clinical studies-part 1.
Evid Based Complement Alternat Med. 2006 Sep;3(3):293-301.
The evidence-based research of the effectiveness of homeopathic medicines in common immunologic disorders is reviewed. In part 1, we introduce methodological issues of clinical research in homeopathy, and criteria utilized to evaluate the literature. Then 24 studies (12 randomized and 12 non-randomized) on common upper respiratory tract infections and otorhinolaryngologic complaints are described. In part 2, the focus will be on allergic diseases and the effectiveness of homeopathy will be globally evaluated and discussed using the criteria of evidence-based medicine. [Abstract/Link to Full Text]

Cooper EL
Regional Strength in CAM.
Evid Based Complement Alternat Med. 2006 Sep;3(3):291-2. [Abstract/Link to Full Text]

Lewith G, Verhoef M, Koithan M, Zick SM
Developing CAM Research Capacity for Complementary Medicine.
Evid Based Complement Alternat Med. 2006 Jun;3(2):283-9.
This article describes initiatives that have been central to the development of complementary and alternative medicine (CAM) research capacity in the United Kingdom, Canada and the United States over the last decade. While education and service delivery are essential parts of the development of CAM, this article will focus solely on the development of research strategy. The development of CAM research has been championed by both patients and politicians, primarily so that we may better understand the popularity and apparent effectiveness of these therapies and support integration of safe and effective CAM in health care. We hope that the perspective provided by this article will inform future research policy. [Abstract/Link to Full Text]

Stumpf SH, Shapiro SJ
Bilateral integrative medicine, obviously.
Evid Based Complement Alternat Med. 2006 Jun;3(2):279-82.
Unstated and unacknowledged bias has a profound impact on the nature and implementation of integrative education models. Integrative education is the process of training conventional biomedical and traditional Chinese medicine practitioners in each tradition such that patient care may be effectively coordinated. A bilateral education model ensures that students in each tradition are cross-taught by experts from the 'other' tradition, imparting knowledge and values in unison. Acculturation is foundational to bilateral integrative medical education and practice. Principles are discussed for an open-minded bilateral educational model that can result in a new generation of integrative medicine teachers. [Abstract/Link to Full Text]

Shmueli A, Shuval J
Satisfaction with Family Physicians and Specialists and the use of Complementary and Alternative Medicine in Israel.
Evid Based Complement Alternat Med. 2006 Jun;3(2):273-8.
Higher utilization of complementary and alternative medicine (CAM) is commonly explained by dissatisfaction or disappointment with conventional medical treatment. To explore, at two points in time in Israel, the associations between six domains of satisfaction (attitude, length of visits, availability, information sharing, perceived quality of care and overall) with conventional family physicians' and specialists' services and the likelihood of consulting CAM providers. This is a secondary analysis of interviews, which were conducted with 2000 persons in 1993 and 2500 persons in 2000, representing the Israeli Jewish urban population aged 45-75 in those years. Bivariate and multivariate analyses were used in the investigation. In 1993, users of CAM were less satisfied than non-users with both family physicians' and specialists' care. Lower satisfaction with the attitude of, the amount of information sharing by and in general with family physicians, and with the length of visits and perceived quality of care of specialists were significantly associated with CAM use. In 2000, lower satisfaction with specialists' attitude, length of visits, availability and in general was significantly related to the use of CAM. Lower satisfaction with family physicians and specialists is significantly associated with consulting CAM providers. However, with CAM becoming a mainstream medical care specialty in its own, lower satisfaction with conventional medicine specialists becomes the most important factor. [Abstract/Link to Full Text]

Jagetia GC, Rao SK
Evaluation of Cytotoxic Effects of Dichloromethane Extract of Guduchi (Tinospora cordifolia Miers ex Hook F & THOMS) on Cultured HeLa Cells.
Evid Based Complement Alternat Med. 2006 Jun;3(2):267-72.
Extracts of Tinospora cordifolia (TCE) have been shown to possess anti-tumor properties, but the mechanism of the anti-tumor function of TCE is poorly understood. This investigation elucidates the possible mechanism underlying the cytotoxic effects of dichlormethane extracts of TCE, after selecting optimal duration and concentration for treatment. HeLa cells were exposed to various concentrations of TCE, which has resulted in a concentration-dependent decline in the clonogenicity, glutathione-S-transferase (GST) activity and a concentration-dependent increase in lipid peroxidation (TBARS) with a peak at 4 h and lactate dehydrogenase (LDH) release with a peak at 2 h. Our results suggest that the cytotoxic effect of TCE may be due to lipid peroxidation and release of LDH and decline in GST. [Abstract/Link to Full Text]

Leite SP, Vieira JR, de Medeiros PL, Leite RM, de Menezes Lima VL, Xavier HS, de Oliveira Lima E
Antimicrobial Activity of Indigofera suffruticosa.
Evid Based Complement Alternat Med. 2006 Jun;3(2):261-5.
Various organic and aqueous extracts of leaves of Indigofera suffruticosa Mill (Fabaceae) obtained by infusion and maceration were screened for their antibacterial and antifungal activities. The extracts were tested against 5 different species of human pathogenic bacteria and 17 fungal strains by the agar-solid diffusion method. Most of the extracts were devoid of antifungal and antibacterial activities, except the aqueous extract of leaves of I. suffruticosa obtained by infusion, which showed strong inhibitory activity against the Gram-positive bacteria Staphylococcus aureus with a minimal inhibitory concentration (MIC) of 5000 microg ml(-1). The MIC values to dermatophyte strains were 2500 microg ml(-1) against Trichophyton rubrum (LM-09, LM-13) and Microsporum canis. This study suggests that aqueous extracts of leaves of I. suffruticosa obtained by infusion can be used in the treatment of skin diseases caused by dermatophytes. [Abstract/Link to Full Text]

Recent Articles in Journal of Negative Results in Biomedicine

No recent articles are currently available.

Recent Articles in The Canadian Journal of Clinical Pharmacology

Pereira JA, Holbrook AM, Dolovich L, Goldsmith C, Thabane L, Douketis JD, Crowther M, Bates SM, Ginsberg JS
Are brand-name and generic warfarin interchangeable? A survey of Ontario patients and physicians.
Can J Clin Pharmacol. 2005;12(3):e229-39.
BACKGROUND: The issue of therapeutic equivalence has been a source of controversy in Canada since the approval of generic warfarin products in 2000. OBJECTIVES: We surveyed Ontario patients and physicians on perceptions of generic warfarin and brand substitution. METHODS: Self-administered questionnaires employed 7.0-point Likert scales of agreement. Patient participants were drawn from a thromboembolism clinic in Hamilton, Ontario. Physician participants were from a random sample of 375 Ontario family physicians, internists, cardiologists and hematologists. RESULTS: Eighty-one patients responded: 52% female, mean age 63.4 years and 63% brand-name warfarin users. Overall, 33% of respondents agreed or strongly agreed that they would feel comfortable taking generic warfarin. However, seventeen percent agreed or strongly agreed that generic warfarin was neither as safe nor as effective as brand-name warfarin, with this view more common amongst patients taking brand-name than those taking generic warfarin. One hundred and ten (29.3%) physicians returned the survey--29% females, mean age 45.3 years, 22% family physicians. Forty-four percent agreed or strongly agreed that they would rather prescribe brand-name than generic warfarin for patients starting warfarin therapy, while 40.7% agreed or strongly agreed that they would not feel comfortable switching from brand-name to generic warfarin. However, only 19.4% of physicians who had switched patients from brand-name to generic warfarin actually reported difficulties in managing the switch. CONCLUSION: While most patients and physicians appear to have accepted the principle of therapeutic equivalence of generic and brand-name warfarin, a sizable minority has concerns that could influence prescribing and compliance. [Abstract/Link to Full Text]

Lau L, Baruchel S
Can Canada sustain paediatric phase I trials? A national survey of cancer relapse in children.
Can J Clin Pharmacol. 2005;12(3):e222-8.
BACKGROUND: Paediatric phase I trials are critical to the evaluation of new agents using standardized methodology. However a large proportion of paediatric patients in Canada do not have access to phase I therapy. OBJECTIVES: A National Paediatric Cancer Relapse Survey was conducted to collect preliminary data to evaluate the feasibility of multi-centre paediatric phase I trials within Canada. METHODS: A survey consisting of 20 individual questions was sent out to all of the 17 paediatric oncology centres in Canada. RESULTS: Fifteen centres (88%) responded to the survey. 1027 children are diagnosed with cancer each year in Canada while 241 present with recurrent cancer. Of the 85 patients who are considered to be eligible for phase I study each year, only 53% were referred for phase I therapy. Two centres have more than 10 eligible patients a year, while the remaining 13 centres have less than 10 eligible patients each year. CONCLUSIONS: We estimate that 20% of the eligible patients could be accrued to phase I trials and Canada may provide sufficient patient number, i.e. 25 to 30 solid tumour patients every 2 years, to allow one multi-centre paediatric phase I trial to be completed over a 2-year period. [Abstract/Link to Full Text]

Holroyd-Leduc JM, Liu BA, Maki BE, Zecevic A, Herrmann N, Black SE
The role of buspirone for the treatment of cerebellar ataxia in an older individual.
Can J Clin Pharmacol. 2005;12(3):e218-21.
BACKGROUND: Buspirone, a 5HT-agonist and D2-dopamine antagonist/agonist, has modest beneficial effects in younger individuals with cerebellar ataxia. However, it is unclear whether it is beneficial and tolerable in older ataxic individuals. OBJECTIVE: To determine if an older individual with cerebellar ataxia would benefit from and tolerate buspirone. METHODS: We performed a single-subject, double-blinded, placebo-controlled randomized-phase study. The 80 year-old subject was to undergo six 4-week testing periods, divided randomly into three treatment and three placebo arms with a 2-week washout period between each arm. Treatment consisted of buspirone hydrochloride. Outcomes were clinical gait and balance testing, posturography testing, and subjective measurement of balance confidence. RESULTS: There were no statistically significant objective improvements with buspirone. The subject experienced a subjective improvement in balance confidence and tolerated treatment. CONCLUSIONS: Single-subject studies can help when it is unclear whether drug trial results with young subjects are generalizable to an older subject. This single-subject study determined that buspirone was tolerable but not clearly beneficial for an ataxic older individual. [Abstract/Link to Full Text]

Koren G
How to increase your funding chances: common pitfalls in medical grant applications.
Can J Clin Pharmacol. 2005;12(2):e182-5.
This commentary identifies 16 items to consider when trying to achieve success with grant applications. [Abstract/Link to Full Text]

Lavoie F, Blais L, Castilloux AM, Scalera A, LeLorier J
Effectiveness and cost-effectiveness of antibiotic treatments for community acquired pneumonia (CAP) and acute exacerbations of chronic bronchitis (AECB).
Can J Clin Pharmacol. 2005;12(2):e212-7.
BACKGROUND: The antibacterial activity, tolerability profile and duration of treatment associated with antibiotics are important therapy attributes when considering treating patients for lower respiratory tract infections (LRTIs), such as community acquired pneumonia (CAP) and acute exacerbations of chronic bronchitis (AECB). OBJECTIVES: To investigate the effectiveness and cost-effectiveness of oral antibiotics used in the treatment of LRTIs. METHODS: A cohort of inhaled corticosteroids users who were diagnosed with a LRTI and dispensed a prescription for one of the antibiotics under study on the same day as the diagnosis was selected from the administrative health databases of the R�gie de l'assurance maladie du Qu�bec (RAMQ). The risks of treatment failure were estimated using a logistic regression analysis. Treatment failure was defined as another prescription for any antibiotic, an emergency room visit or hospitalization for LRTIs, or death, in the 20 days following the dispensation of the first antibiotic prescribed. A cost-minimization analysis was performed in which only the drug costs related to the first antibiotic filled were considered. RESULTS: A total of 3,610 episodes of LRTIs were studied. There were no significant differences between antibiotics in terms of their respective adjusted odds ratios for rates of failure. However, the lower cost associated with azithromycin was significantly different from the costs associated with any other antibiotic (p<0.0001). CONCLUSION: Clinical effectiveness appears to be similar amongst second line antibiotics that are commonly used in the treatment of LRTIs in the community. Using a cost-minimization analysis, azithromycin appears to be the most cost-effective antibiotic treatment in this setting. [Abstract/Link to Full Text]

Moride Y, Ducruet T, Boivin JF, Lavoie F, Rochon S
Utilization of non-steroidal anti-inflammatory drugs in Quebec: adherence to the Canadian consensus on prescription guidelines.
Can J Clin Pharmacol. 2005;12(2):e201-11.
BACKGROUND: Adverse events associated with the use of non-steroidal anti-inflammatory drugs (NSAIDs) have led to the publication of Canadian prescription guidelines. Prescription practices following the publication of these guidelines and the introduction of COX-2 inhibitors in the Quebec formulary of reimbursed medications remain largely unexplored. OBJECTIVES: To compare the prevalence of contra-indications and selected risk factors for NSAID-toxicity among COX-2 inhibitor users and non-selective NSAID users. METHODS: A case-control analysis was conducted in a random sample of Quebec adult drug plan members who were treated with celecoxib (n=42,422 cases), rofecoxib (n=25,674 cases), full-dose (anti-inflammatory doses) of non-selective NSAIDs (n=9,673 cases), or low-dose NSAIDs (n=2,745 controls) in the year 2000. Data were obtained from the Quebec prescription and medical services databases (RAMQ). RESULTS: Patients with a history of gastropathy were more likely to be prescribed COX-2 inhibitors than low-dose NSAIDs; the odds ratios were 1.73 (95%CI: 1.56-1.91) and 1.49 (1.33-1.66), respectively for celecoxib and rofecoxib. Corresponding results for concomitant use of anticoagulants were 1.95 (1.34-2.83) for celecoxib and 1.87 (1.26-2.77) for rofecoxib, and for use of corticosteroids they were 1.29 (1.08-1.54) and 1.23 (1.01-1.49). Conversely, patients with the following characteristics were less likely to receive COX-2 inhibitors than low-dose non-selective NSAIDs: age 75+ (OR=0.64; 0.56-0.72 for celecoxib, OR=0.48; 0.76-0.99 for rofecoxib), hypertension (OR=0.83; 0.75-0.92 for celecoxib, OR=0.87; 0.77-0.97 for rofecoxib), and concomitant use of diuretics (OR=0.72; 0.63-0.82 for celecoxib; OR=0.77; 0.66-0.89 for rofecoxib). CONCLUSION: Patients with risk factors for NSAID gastropathy were more likely prescribed COX-2 inhibitors, while the presence of other contra-indications led to the prescription of low-dose non-selective NSAIDs. However, 12.7% of users of full-dose non-selective NSAIDs were age 75+ and 12.0% had a history of gastropathy, which are considered important risk factors for adverse events. [Abstract/Link to Full Text]

Selby P, Kapur B, Hackman R, Koren G
No one asked the baby -- an ethical issue in placebo-controlled trials in pregnant smokers.
Can J Clin Pharmacol. 2005;12(2):e180-1.
This case report involving a placebo-controlled nicotine patch trial illustrates the difficult issue of conducting placebo studies in pregnancy, when one of the two patients involved cannot be asked to consent. [Abstract/Link to Full Text]

Sketris IS, Kephart G, Cooke CA, Skedgel CD, McLean-Veysey PR
Use of physician profiles to influence prescribing of topical corticosteroids.
Can J Clin Pharmacol. 2005;12(2):e186-97.
BACKGROUND: Physician profiling is a tool used to attempt to affect changes in prescribing. The Drug Evaluation Alliance of Nova Scotia (DEANS) decided to implement a physician profiling project to determine if prescribing of topical corticosteroids could be altered. OBJECTIVES: To evaluate a DEANS initiative utilizing physician prescribing profiles to shift prescribing of topical corticosteroids from higher to lower potency agents in beneficiaries of the Nova Scotia Seniors' Pharmacare Program. METHODS: Administrative claims from the Nova Scotia Seniors' Pharmacare program were used to identify prescriptions for topical corticosteroids. Prescriptions were summarized at the individual physician level, and aggregated by Anatomical Therapeutic Classification into weak, moderately potent, potent and very potent products. The number of prescriptions for topical corticosteroids was compared for the twelve-month period before and after mailing of the profiles. Overall results were aggregated by utilization and expenditures. RESULTS: The number of prescriptions for topical corticosteroids per physician profiled was 44.0 in 2000/2001 and 42.8 in 2001/2002 (p = NS) and the expenditures per physician profiled were 838.94 dollars in 2000/2001 and 826.81 dollars in 2001/2002 (p = NS). There was a small decrease in prescriptions dispensed for potent topical products over the profiling period (52.4% of prescriptions in 2000/2001 versus 51.5% of prescriptions in 2001/2002, p=0.03). Otherwise, changes in utilization or expenditures for topical corticosteroids were not statistically different between the profiling periods. CONCLUSIONS: This project showed that mailing unsolicited individual-level profiles did not alter prescribing or expenditures for topical corticosteroids over a two-year period. Further work is needed to determine physician attitudes towards such projects. [Abstract/Link to Full Text]

Zaidi AN
Anticonvulsant hypersensitivity syndrome leading to reversible myocarditis.
Can J Clin Pharmacol. 2005;12(1):e33-40.
A 67-year old Caucasian female was diagnosed with anticonvulsant hypersensitivity syndrome (AHS) after she developed the triad of high fevers, maculo-papular rash and internal organ involvement ten weeks after the institution of prophylactic phenytoin for resection of a meningioma. She developed congestive heart failure, with a substantial reduction in ejection fraction (EF) by an echocardiogram and serum cardiac enzyme elevation. In the setting of AHS, this was consistent with a drug-induced myocarditis. Treatment consisted of removal of the offending drug, diuretics and high dose steroids. Six weeks later her symptoms had completely resolved, with a return to a normal EF. [Abstract/Link to Full Text]

Ahn E, Kapur B, Koren G
Study on circadian variation in folate pharmacokinetics.
Can J Clin Pharmacol. 2005;12(1):e4-9.
BACKGROUND: In a new preparation of prenatal multivitamins, PregVit, two tablets a day (a.m. and p.m.) are given. Folic acid is separated from iron and zinc and is given in the p.m. tablet to overcome problems due to folic acid interactions with iron or zinc, and frequent presence of nausea and vomiting of pregnancy in the morning. The circadian variation of folate in humans has not been investigated. This is the first study attempting to determine whether circadian variation of folate pharmacokinetics exists in humans. OBJECTIVES: To determine whether circadian rhythm of folate pharmacokinetics exists in humans. METHODS: In a crossover design, six healthy, non-pregnant women were randomized to receive 1 tablet of PregVit p.m., containing 1.1 mg of folic acid, in the morning or evening. Serum folate levels were measured over 10 hours. The area under the concentration-time curve (AUC) was used to compare the extent of absorption between the two time periods. RESULTS: The mean AUC values for serum folate after administration of PregVit p.m. were 334.5+/-119.6 nM*h and 283.1+/-64.3 nM*h for morning and evening, respectively (P = 0.17). The morning and evening peak serum folate concentrations were also similar (135.3+/-41.7 nM and 130.3+/-14.2 nM, respectively) (P = 0.75). Similarly, the time to peak for the morning arm (1 0.5 hour) was similar to evening administration (1+/-0.4 hour). CONCLUSIONS: There is no evidence of circadian variation in folate pharmacokinetics. Thus, the introduction of folate in PregVit p.m. will not affect its effectiveness as compared to its routine administration in the morning. [Abstract/Link to Full Text]

Sitar DS
Old drugs - old people - new insights.
Can J Clin Pharmacol. 2005;12(1):e28-32.
Dr. Dan Sitar was the recipient of the 2004 CSCP Senior Investigator Award at the First Canadian Therapeutics Congress held in June 2004. He presented a lecture highlighting some of the studies he participated in that have contributed to an increased understanding of the role of aging on drug disposition and effect. [Abstract/Link to Full Text]

Gill SS, Bronskill SE, Mamdani M, Sykora K, Li P, Shulman KI, Anderson GM, Hillmer MP, Wodchis WP, Rochon PA
Representation of patients with dementia in clinical trials of donepezil.
Can J Clin Pharmacol. 2004;11(2):e274-85.
OBJECTIVES: To evaluate the representation of frail older adults in randomized controlled trials (RCTs), and to assess consequences of under representation by analyzing drug discontinuation rates. METHODS: A cohort of older adults newly dispensed donepezil in Ontario between September 2001 and March 2002 was constructed using administrative data. A systematic review of the literature identified RCTs of donepezil. Patients dispensed donepezil were then compared to clinical trial subjects. Discontinuation rates were examined for patients with and without potential contraindications to this drug. RESULTS: There were 6,424 older adults in the Ontario cohort with new claims for donepezil. Ten RCTs evaluating the use of donepezil were identified (n = 3,423). Between 51% and 78% of the Ontario cohort would have been ineligible for RCT enrollment. Patients dispensed donepezil were older (80.3 vs. 73.7 years, p < 0.001) and more likely to be in long-term care (14.1 vs. 7.1%, p < 0.001) than RCT subjects. Overall, 27.8% of the Ontario cohort discontinued donepezil within seven months of initial prescription. Discontinuation rates were significantly higher for patients with a history of obstructive lung disease, active cardiovascular disease, or Parkinsonism. CONCLUSIONS: Fewer than half of the older adults dispensed donepezil in Ontario would have been eligible to participate in the RCTs that established the efficacy of this drug. Discontinuation rates were higher among patient groups not represented in the trials. Clinicians should carefully assess the potential risks and benefits of such drug therapies for older patients with dementia. [Abstract/Link to Full Text]

Morgan SG, Yan L
Persistence with hypertension treatment among community-dwelling BC seniors.
Can J Clin Pharmacol. 2004;11(2):e267-73.
BACKGROUND: Previous research has documented low levels of persistence with prescribed hypertension treatment in Canada. With growing recognition of the value of appropriate drug therapy, rates of persistence may be improving over time. The purpose of this study was to examine persistence with prescribed hypertension treatment among newly treated community-dwelling seniors in British Columbia. METHODS: BC PharmaCare data was used to determine the cohort of seniors who were newly-treated hypertensives over the period 1993 to 2000. Medical and hospital claims from the BCLHD were searched for diagnoses indicating the presence of essential hypertension and potentially confounding conditions. Rates of persistence with drug therapy were analysed, accounting for patient, age, sex, clinical complexity, the existence of potentially confounding conditions, and type of drug first prescribed. RESULTS: For the period 1993 to 2000, 82,824 seniors were identified as new users of hypertension drugs with diagnosed essential hypertension. Fifty-one percent of these newly-treated hypertensives filled a contiguous series of hypertension prescriptions for at least one full year. There was a slight improvement in the rate of persistence over time (p<0.001). Evidence of specific co-morbidities that potentially complicate essential hypertension increased the likelihood of persistence among first-time users (p<0.001), whereas greater overall clinical complexity decreased the likelihood of persistence (p<0.001). Persistence was highest amongst patients initiated on newer anti-hypertensive drug therapies. CONCLUSIONS: Despite modest improvement, persistence with hypertension treatment among the elderly is very low. Further research into the reasons for non-persistence would be advanced through primary data collection, including survey-based research. New policies and practices are needed to encourage persistence with evidence-based therapies. [Abstract/Link to Full Text]

Rubin ET, Lee A, Ito S
When breastfeeding mothers need CNS-acting drugs.
Can J Clin Pharmacol. 2004;11(2):e257-66.
BACKGROUND: Breastfeeding is the ideal method of infant nutrition. However, if mothers need medications such as the central nervous system (CNS) acting drugs, infant safety concerns arise. Summarized information on infant exposure levels to drugs in milk and associated side effect profiles will help clinicians to rationalize and justify important drug therapy for a breastfeeding patient. METHODS: Electronic searches of MEDLINE and PsycINFO from 1966-2003, and of EMBASE from 1980-2003, were conducted for studies on breastfeeding or breast milk and medications in the following categories: antidepressants, antipsychotics, antiepileptics (or anticonvulsants) and anxiolytics. The infant exposure level (%) was defined as follows: [Drug concentration in milk (mg/mL)] x [Daily milk intake (mL/kg/d)] x 100 / Maternal dose (mg/kg/d). RESULTS: A total of 129 papers were eligible for analyses. Our findings indicate that the majority of the CNS-acting drugs, if taken by nursing women, result in average exposure levels to their breast-fed infants of less than 10% of the therapeutic doses per kg body weight. Exceptions are lithium, ethosuximide, phenobarbital, primidone, lamotrigine and topiramate. Adverse effect profiles do not always correlate with a higher exposure level. Overall, most reported adverse effect profiles appear benign. Where adverse effects were reported, they were often confounded by intrauterine exposure. CONCLUSIONS: CNS-acting drugs taken by the mother do not appear to pose any major risks of immediate adverse effects to the breastfeeding infant, although with most of the newer drugs further research is needed to be conclusive. [Abstract/Link to Full Text]

Shah BR, Mamdani M, Jaakkimainen L, Hux JE
Risk modification for diabetic patients. Are other risk factors treated as diligently as glycemia?
Can J Clin Pharmacol. 2004;11(2):e239-44.
BACKGROUND: The importance of glucose control is recognized both by patients with diabetes and their physicians. However, other preventative interventions, such as using medications to manage lipid and blood pressure levels, are underused for diabetic patients. OBJECTIVES: To determine whether patients with diligent glucose management are more likely to use medications that treat lipids and blood pressure. METHODS: Administrative data records were evaluated for all diabetic patients aged 65 or older residing in Ontario in 1999 without pre-existing coronary artery disease (n=161,553). Measures of diligent glucose management were insulin use and frequent capillary glucose testing ((3) 2 per day). Outcomes were prescription of a lipid-lowering drug or antihypertensive drug. Using multivariate modeling, odds ratios for each diligence measure were determined for each outcome, adjusting for age, sex, comorbidities, and other covariates. RESULTS: Patients using insulin did not have a clinically important difference in lipid-lowering drug use (adjusted odds ratio 0.9, 99% confidence interval 0.9 - 1.0, P=0.002) or antihypertensive drug use (adjusted odds ratio 1.1, 99% confidence interval 1.0 - 1.1, P<0.001) versus non-users. Adjusted odds ratios for frequent glucose testing were not significantly different from unity for either lipid-lowering or antihypertensive drug use. CONCLUSIONS: Patients who required and were capable of diligent glucose management, which is invasive, expensive and time-consuming, were no more likely to use medications to control lipids or blood pressure. Preventative care for patients with diabetes may be too focused on glycemic control, and may be neglecting the management of other cardiovascular risk factors. [Abstract/Link to Full Text]

C�t� I, Gr�goire JP, Moisan J, Chabot I
Quality of life in hypertension: the SF-12 compared to the SF-36.
Can J Clin Pharmacol. 2004;11(2):e232-8.
BACKGROUND: The SF-36 has frequently been used to measure health related quality of life (HRQOL) in hypertension. Recently, the SF-12, a shorter form of the SF-36, has been proposed. However, the validity of the SF-12 in hypertension has not yet been assessed. OBJECTIVES: To determine the extent to which the SF-12 provides similar measurements of HRQOL to those of the SF-36 in hypertensive individuals. METHODS: A study assessing the impact of a pharmacy-based intervention program on hypertensive individuals served as background for this study. One hundred and twelve individuals participated in this study. We compared the SF-36 with the SF-12 on item scores and summary measures using intraclass correlation coefficients (ICC), Pearson correlation coefficients and linear regression. RESULTS: The concordance between the SF-12 and the SF-36 on both physical (ICC=0.88) and mental (ICC=0.92) component summary scores (PCS and MCS respectively) is high and the relationship is linear and positive. Most of the variance in the SF-36 PCS (R2=0.78) and MCS (R2=0.85) can be explained by their SF-12 counterparts. The SF-12 PCS and MCS are the only significant predictor variables for the corresponding measure of the SF-36. CONCLUSIONS: The SF-12 appears to be a valid alternative to the SF-36 for clinical practice or research purposes when studying hypertensive individuals and their treatment. [Abstract/Link to Full Text]

Leonard B, Huff H, Merryweather B, Lim A, Mills E
Knowledge of safety and herb-drug interations amongst HIV+ individuals: a focus group study.
Can J Clin Pharmacol. 2004;11(2):e227-31.
OBJECTIVE: To determine how HIV+ individuals access safety and knowledge of drug interactions related to complementary and alternative medicine (CAM). METHODS: We conducted two separate focus group sessions with HIV+ users of complementary therapies. A total of 8 men participated at an urban health centre. Focus group sessions were audio taped and transcribed verbatim. Analysis was conducted independently and in duplicate, using thematic analysis. RESULTS: All focus group participants described their use of CAM as very important for their health maintenance, giving them a feeling of empowerment in their health care. Potential side effects and safety issues were indicated as major concerns for treatment decisions, but the participant's knowledge of safety issues involved in CAM care for HIV+ patients was limited. The sources used by the participants to gather information regarding safety and interactions with medications were varied but included: their CAM providers, their physicians, books, resources from AIDS Service Organizations, the internet and health food stores. Participants acknowledged that appraising the quality of such information is difficult. CONCLUSIONS: The participants in this study had a strong trust in CAM and used a wide variety of sources to gather information on CAM safety, though their knowledge base was poor. As the use of CAM grows, further research on how to disseminate reliable information on safety and efficacy to this potentially vulnerable population is required. [Abstract/Link to Full Text]

McIntyre RS, Mancini DA, Srinivasan J, McCann S, Konarski JZ, Kennedy SH
The antidepressant effects of risperidone and olanzapine in bipolar disorder.
Can J Clin Pharmacol. 2004;11(2):e218-26.
OBJECTIVE: To describe the antidepressant effectiveness of olanzapine and risperidone and compare their tolerability when employed adjunctively in bipolar I/II disorder. METHOD: In an observational study, twenty-one ambulatory subjects with DSM-IV defined bipolar I/II disorder, in any phase of the illness, openly received adjunctive risperidone or olanzapine. The primary efficacy parameters were the Hamilton Depression Rating Scale (HDRS-17) and the Maier and Philips Severity Subscale. Secondary efficacy parameters included the Young Mania Rating Scale (YMRS) along with the Clinical Global Impressions Scale (CGI). Response was defined as a significant change from baseline to endpoint in the total mean HDRS-17 score. The primary tolerability parameters were the Abnormal Involuntary Movement Scale (AIMS) along with changes in weight and body mass index (BMI-kg/m2). Patients were evaluated prospectively with repeated monthly assessments for up to 6 months. RESULTS: Eleven patients openly received risperidone; 10 received olanzapine adjunctive to either lithium or divalproex. Total mean HDRS-17 scores significantly decreased from baseline to endpoint in both groups (p=0.001), with the mean HDRS-17 total scores falling from 17(SD=3.2) to 5(SD=1.5) by 6 months in the risperidone-treated group and from 18 (SD=1.9) to 7 (SD=2.0) in the olanzapine-treated group. Differences between the risperidone-treated group and the olanzapine-treated group were not significant at 6 months (p=0.754). The mean doses of study medication were 2.88 (SD=1.6) mg/day for the risperidone-treated group and 12.69 (SD=2.3) mg/day for the olanzapine-treated group. Both risperidone and olanzapine were generally well tolerated. No patients developed tardive dyskinesia. Significant weight gain was experienced by patients in both groups [mean weight gain at endpoint was 5.9 kg in risperidone (p=0.023) and 11.3 kg in olanzapine (p=0.001)]. There was a significant difference in weight gain between the risperidone-treated group and the olanzapine-treated group (p=0.001). CONCLUSIONS: These pilot data, from the first prospective comparison study of risperidone and olanzapine in bipolar disorder, suggest that adjunctive administration of either agent may reduce depressive symptom severity. No subjects receiving risperidone or olanzapine developed tardive dyskinesia. Both compounds imparted substantial weight gain with significantly more weight gain accrual with olanzapine. As this was an observational study, the antidepressant effect and tolerability profile of these compounds requires validation via double-blind placebo controlled investigations. [Abstract/Link to Full Text]

Oh PI, Cohen EA, Mittmann N, Seung SJ
The economics of adjunctive therapies in coronary angioplasty: drugs, devices, or both?
Can J Clin Pharmacol. 2004;11(2):e202-11.
BACKGROUND: Abciximab reduces the number of ischemic events in patients undergoing angioplasty compared to standard therapy. Coronary stenting reduces the need for repeat procedures. Abciximab or stents individually are considered cost effective interventions. There is a need to quantify the economic value of the combination of abciximab and stenting over stenting alone. METHODS: A decision analytic model was developed incorporating the outcomes from the EPISTENT study. Costs from Canadian sources for hospitalization, procedures and medications were used. Life expectancy was estimated using a Markov model. Total expected costs and outcomes of the abciximab and stent vs. stent alone were compared in an incremental analysis. The perspective of the analysis was a Canadian teaching hospital. RESULTS: The acquisition cost for abciximab was partially offset by reduced costs for managing clinical events resulting in a net incremental cost of 1,076 dollars per patient over one year (8,617 dollars combination vs. 7,541 dollars stent alone). This added cost was accompanied by a reduction in large MI or death by an absolute rate of 5.7% at one year (5.3% combination vs. 11.0% stent alone), yielding an incremental cost-effectiveness ratio of 18,877 dollars per death or large MI averted. The long-term survival gain was 0.15 to 0.37 years yielding an attractive incremental cost effectiveness ratio of 2,832 dollars to 7,173 dollars per life year gained. CONCLUSIONS: The combination of abciximab and stenting versus stenting alone provides improved clinical outcomes at a very reasonable cost from the Canadian hospital perspective. [Abstract/Link to Full Text]

Gedevanishvili A, Chamoun A, Uretsky BF, Rahman AM
Acute coronary syndrome induced by intravenous ephedrine in pregnant woman with normal coronaries.
Can J Clin Pharmacol. 2004;11(2):e195-8.
Intravenous ephedrine administered during a C-section was observed to cause an acute coronary syndrome in a pregnant woman with normal coronaries. The patient developed sub-sternal chest pain, was noted to have 10 beats of non-sustained ventricular tachycardia, ST abnormalities were observed on her ECG and cardiac enzymes were elevated. The patient had normal coronary arteries by angiogram and during a one-year period of follow up no further cardiac events occurred. [Abstract/Link to Full Text]

Austin PC, Mamdani MM, Tu K
The impact of the Women's Health Initiative study on incident clonidine use in Ontario, Canada.
Can J Clin Pharmacol. 2004;11(2):e191-4.
BACKGROUND: Following publication of the Women's Health Initiative (WHI) study, many women discontinued use of estrogen replacement therapy. There is some evidence that the antihypertensive agent clonidine can reduce the frequency of hot flashes associated with menopause. OBJECTIVES: To determine the impact of the WHI study on incident use of clonidine in elderly women in Ontario, Canada. METHODS: Retrospective, population-based administrative database design. Data on all residents of Ontario over the age of 65 years were included. Time series methods were used to analyze change in incident clonidine use following publication of the WHI study. RESULTS: Following publication of the WHI study, incident use of clonidine increased substantially among elderly women in Ontario, Canada. Similar trends were not observed for incident use of other antihypertensive medications. CONCLUSION: During a period of time in which a large proportion of women discontinued estrogen replacement therapy, incident use of clonidine increased. There is some evidence that a small number of women may have sought alternative relief from menopausal symptoms using other pharmacological therapies. [Abstract/Link to Full Text]

Casciano R, Tarride JE, Breton MC, Stern L, Langer A
A pharmacoeconomic evaluation of the myocardial ischemia reduction with aggressive cholesterol lowering (MIRACL) study in Canada.
Can J Clin Pharmacol. 2004;11(1):e179-90.
OBJECTIVE: To determine a 16-week total healthcare cost and the cost-effectiveness of short-term, lipid-lowering therapy with atorvastatin 80 mg following acute coronary syndrome (ACS) in Canada. METHODS: The expected costs per patient on atorvastatin 80 mg per day and placebo were compared using clinical outcome data from the MIRACL study and cost data from the Ontario Case Costing Project and the Ontario Schedule of Benefits. The cost per event avoided was also assessed. The clinical outcomes measured included: death, cardiac arrest, non-fatal myocardial infarction (MI), fatal MI, angina pectoris, stroke, congestive heart failure, and surgical or percutaneous coronary revascularizations. All direct medical costs from the perspective of the Canadian health care system were taken into account. RESULTS: The total expected cost per patient was 2,590 dollars in the placebo group and 2,639 dollars in the atorvastatin group. The incremental cost of atorvastatin treatment (49.26 dollars per patient) corresponded to a cost of 1,285 dollars per event avoided. The cost savings obtained through the reduction in events offset 86% of the cost of atorvastatin treatment. Budget impact analysis revealed that increased rates of atorvastatin usage following ACS were associated with large numbers of events avoided at a small additional cost when projected to the Canadian population. CONCLUSIONS: In Canada, the clinical benefits of intensive short-term atorvastatin treatment administered within 96 hours after ACS were associated with a favorable cost-effectiveness ratio. The incremental cost of atorvastatin is mostly offset by savings due to the reduction in events in patients treated with atorvastatin. [Abstract/Link to Full Text]

Clemons M, Enright K, Cesta A, Charbonneau F, Chow E, Warr D, Kee-Cresswell D, Chang J, Yogendran G, Trudeau M, De Angelis C, Cottrell W, Dranitsaris G
Do physicians follow systemic treatment and funding policy guidelines?
Can J Clin Pharmacol. 2004;11(1):e168-78.
BACKGROUND: The use of bisphosphonates for the prevention of skeletal related events in women with bone metastases from breast cancer is well established. We undertook an evaluation of bisphosphonate use in clinical practice in three Canadian cancer centres. In addition we assessed whether or not physicians at these centres are following their local treatment guidelines and funding policies. METHODS: Charts and electronic files of patients who had received either clodronate or pamidronate at any time between January 2000 and December 2001 at three Canadian cancer centres were retrospectively reviewed. RESULTS: There has been a marked improvement in the time between the diagnosis of bone metastases and the commencement of bisphosphonates from a median of 155 days in 1998 to 24 days in 2001. However, despite a local funding policy requiring that oral clodronate be the first bisphosphonate used, this was the case in only 67% of patients. In addition, despite one centre's guidelines recommending that bisphosphonates be stopped once the patient was progressing, 90% of their patients remained on bisphosphonates until they died. CONCLUSIONS: A considerable amount of effort is spent on the creation of "evidence based" treatment guidelines. Funding agencies develop policies based on these treatment guidelines, but often funding is more restrictive than the treatment guideline would suggest. It is clear from this review that physicians still appear to manage a substantial proportion of patients outside of funding policies, but within evidence based recommendations. Therefore, a need exists for either the creation of guidelines and policies that physicians will follow or the implementation of methods to ensure that restrictive policies are actually followed. [Abstract/Link to Full Text]

Boucher M, Pharand C, Skidmore B
A critical appraisal of the CURE trial: role of clopidogrel in non-ST-segment elevation acute coronary syndromes.
Can J Clin Pharmacol. 2004;11(1):e156-67.
BACKGROUND: A clinical study, the CURE trial, compared the use of clopidogrel/acetylsalicylic acid (ASA) to ASA alone in 12,562 patients with non-ST-segment elevation acute coronary syndromes (ACS). Results of the trial suggested a possible first-line role for the more expensive combination of clopidogrel/ASA. OBJECTIVE: To perform a critical appraisal of the CURE trial, to determine the efficacy and safety of the clopidogrel/ASA combination in the management of ACS patients and to describe the population most likely to benefit from this combination. METHODS: A critical appraisal of the CURE trial was conducted. RESULTS: The CURE trial was found to be of high quality (Jadad score 5/5). An absolute risk reduction (ARR) of 2.1% was seen for the clopidogrel/ASA combination for the first primary outcome (death from cardiovascular causes, non-fatal myocardial infarction (MI), or stroke), compared to ASA alone. A 2.3% ARR was seen for the clopidogrel/ASA combination for the second primary outcome, which included the first primary outcome or refractory ischemia. The clinical benefit appears to have mainly been driven by a reduction in the risk of non-fatal MI. A 1% absolute risk increase (ARI) was observed for major bleeding in the clopidogrel/ASA group. Also, 5.2% of subjects in the clopidogrel/ASA group discontinued their study medication for adverse events other than bleeding, thrombocytopenia or allergy, compared to 3.5% in the ASA group. CONCLUSIONS: We established that the overall quality of the CURE trial was good. Compared to ASA, the clopidogrel/ASA combination reduces the risk of recurrent vascular ischemic events in non-ST elevation ACS patients. The main clinical benefit however appears to be limited to a reduction in the risk of non-fatal MI. This benefit needs to be interpreted in light of the associated increased bleeding risk. Given that the risk of MI is elevated in high-risk ACS patients, the benefit of clopidogrel/ASA combination is expected to outweigh the bleeding hazards for this population. As details of all adverse events were not reported, it was not possible to fully evaluate the safety of use of this intervention. [Abstract/Link to Full Text]

Ratnapalan S, Ito S
Pediatric resident education and needs assessment in clinical pharmacology.
Can J Clin Pharmacol. 2004;11(1):e150-5.
Objective: To identify perceived and unperceived educational needs of residents to organize a seminar series in clinical pharmacology. METHOD: All pediatric residents (48) and all attending general pediatric staff (20) were sent structured questionnaires with potential seminar topics. Data from previous pharmacy chart audits and complaints lodged with patient care representatives were analyzed as the environmental scans. RESULTS: There was a 75% response rate from both residents and staff. The responses were very similar and the only significant difference was the response to a seminar on correcting electrolyte imbalances which the residents favoured (p = 0.005). The environmental scans identified pain management as one of the main areas needing improvement. CONCLUSION: Perceived learning needs of residents are similar but not identical to those identified by the faculty. Environmental scanning can be used to identify unperceived learning needs. [Abstract/Link to Full Text]

Tett SE
A perspective on Australia's National Medicines Policy.
Can J Clin Pharmacol. 2004;11(1):e28-38.
There is international interest in Australia's health care system for prescription medicines. The issue is particularly topical in Canada with the debate following publication of the Romanow Report into the future of health care in Canada. This Report recommended a new National Drug Agency. Australia has a National Medicines Policy with four arms-quality, safety and efficacy of medicines; equity of access; a viable and responsible pharmaceutical industry; quality use of medicines. The four arms of the Policy are interlinked and interdependent for optimal functioning. In this paper, an overview of how the prescription drug system in Australia works is presented. The manuscript focuses upon specific aspects of the Policy, describing how it functions and some of the processes integral to success, from the viewpoint of the author. The discussion includes some of the advantages of Australia's system for pharmaceuticals as well as some of the problems, as these present opportunities for development and change. [Abstract/Link to Full Text]

Lee M, Pao D, Hsu T, Sonderskov A
Cost savings and effectiveness of outpatient treatment with low molecular weight heparin of deep vein thrombosis in a community hospital.
Can J Clin Pharmacol. 2004;11(1):e17-27.
This study was conducted at Centenary Health Centre of the Rouge Valley Health System, a community based hospital in Toronto. In January 1997, a new treatment was introduced for the management of patients with uncomplicated deep vein thrombosis (DVT). Eligible patients presenting at the ER were placed on LMWH (tinzaparin) and followed at home. Previously the patients had been hospitalized and treated with intravenous heparin until they reached a therapeutic international normalized ratio (INR). The intent of this study was to evaluate the patient outcomes and cost-savings of the new approach. METHODS: Data from all patients eligible for home care, treated in 1996 were assembled and compared with those from all eligible patients treated from April 1, 1997 to March 31, 1998. The data was collected by chart review and consisted of patient outcomes and costs during the period of heparin treatment. Costs for hospitalized patients were based on a per diem. For home care patients, the costs were itemized according to service and medication usage. All costs were calculated in 1999 Canadian dollars. RESULTS: In each one year period, 39 cases were treated. There was no serious adversity and the outcomes were compatible with what has been reported in the literature. The mean cost per patient for the 1996 hospitalized cohort was $3,266 compared to $584 for the subsequent home care cohort. The difference was statistically significant (p<0.00001). CONCLUSION: Home care with tinzaparin compared to hospital care with IV heparin resulted in a large mean saving per patient with no difference in outcome. [Abstract/Link to Full Text]

Ong D, Popat A, Knowles SR, Arrowood JS, Shear NH, Binkley KE
Objective psychological measurement and clinical assessment of anxiety in adverse drug reactions.
Can J Clin Pharmacol. 2004;11(1):e8-16.
BACKGROUND: A confounding factor in the diagnosis of adverse drug reactions (ADRs) is the psychological state of the patient. Patients with underlying anxiety and related disorders may present with psychogenic reactions, which involve physiologic responses originating from psychological, rather than organic factors. OBJECTIVE: To examine the contribution of anxiety and related disorders to adverse drug events. METHODS: Participants from an adverse drug reaction clinic completed the Trauma Symptom Checklist-40 (TSC-40), a 40-item questionnaire consisting of six subscales: anxiety, depression, dissociation, sexual abuse trauma index (SATI), sexual problems, and sleep disturbance. Physicians assessed the likelihood that adverse events were due to anxiety or drug(s) by providing an anxiety score (0 to 10) and an ADR score (0 to 10), respectively, for each participant. RESULTS: Patients clinically assessed as having "high anxiety" (anxiety score 7-10 and ADR score 0-3; n = 11) scored higher than patients clinically assessed as having a "true ADR" (anxiety score 0-3 and ADR score 7-10; n = 19) on the TSC-40 total (P = 0.006) as well as anxiety (P = 0.012), depression (P = 0.007), and SATI subscales (P = 0.016). CONCLUSION: This study is the first to use a validated psychological measurement to indicate that a substantial percentage of reported adverse drug events may in fact be a manifestation of underlying anxiety and/or related disorders. We suggest that mechanisms of symptom generation may be analogous to those operative in idiopathic environmental intolerance. [Abstract/Link to Full Text]

Ipp M, Taddio A, Goldbach M, Ben David S, Stevens B, Koren G
Effects of age, gender and holding on pain response during infant immunization.
Can J Clin Pharmacol. 2004;11(1):e2-7.
Determinants of infant pain responses are important when assessing the efficacy of analgesics. In a randomized controlled trial, 106 infants aged 2 to 6 months were positioned either supine (SUP) on the examination table or held (HLD) by a parent during routine immunization in a community pediatric office. There was no difference between the SUP and HLD infants in duration of crying, facial grimacing or visual analogue scale (VAS) pain scores. Similarly gender did not affect pain response. In contrast, 2-month-old infants displayed more pain during immunization than did 4 or 6-month-old infants. [Abstract/Link to Full Text]

Recent Articles in Journal of Pharmacy & Pharmaceutical Sciences

Nachtigal P, Jamborova G, Pospisilova N, Pospechova K, Solichova D, Zdansky P, Semecky V
Atorvastatin has distinct effects on endothelial markers in different mouse models of atherosclerosis.
J Pharm Pharm Sci. 2006;9(2):222-30.
PURPOSE: Atherosclerosis is a progressive process that initially involves endothelial dysfunction. We investigated the effects of atorvastatin on both lipid parameters, and VCAM-1 and ICAM-1 expression in apoE-deficient or wild type C57BL/6J mice. METHODS:The C57BL/6J mice were fed with either chow or an atherogenic diet for 12 weeks. Male apoE-deficient mice were fed with the chow diet for 12 weeks. In 3 atorvastatin treated groups mice were fed the same diet as described above except atorvastatin was added to the diet at the dosage of 10 mg/kg per day for the last 8 weeks before euthanasia. RESULTS: Biochemical analysis showed that atorvastatin significantly decreased total cholesterol levels and VLDL in C57BL/6J mice fed with atherogenic diet but increased serum lipid levels in apoE-deficient mice. Stereological analysis of the immunohistochemical staining revealed that atorvastatin reduced endothelial expression of ICAM-1 and VCAM-1 only in C57BL/6J mice on chow diet. CONCLUSION: We have demonstrated that endothelial expression of both VCAM-1 and ICAM-1 does not correlate with cholesterol levels in these mice. Moreover, we showed that 8-week administration of atorvastatin decrease endothelial expression of VCAM-1 and ICAM-1 in C57BL/6J wild type mice beyond its lipid lowering effect but not in C57BL/6J wild type mice fed by atherogenic diet or in apoE-deficient mice. [Abstract/Link to Full Text]

Guangli M, Yiyu C
Predicting Caco-2 permeability using support vector machine and chemistry development kit.
J Pharm Pharm Sci. 2006;9(2):210-21.
PURPOSE: To predict Caco-2 permeability is a valuable target for pharmaceutical research. Most of the Caco-2 prediction models are based on commercial or special software which limited their practical value. This study represents the relationship between Caco-2 permeability and molecular descriptors totally based on open source software. METHODS:The Caco-2 prediction model was constructed based on descriptors generated by open source software Chemistry Development Kit (CDK) and a support vector machine (SVM) method. Number of H-bond donors and three molecular surface area descriptors constructed the prediction model. RESULTS:The correlation coefficients (r) of the experimental and predicted Caco-2 apparent permeability for the training set and the test set were 0.88 and 0.85, respectively. CONCLUSION: The results suggest that the SVM method is effective for predicting Caco-2 permeability. Membrane permeability of compounds is determined by number of H-bond donors and molecular surface area properties. [Abstract/Link to Full Text]

de F Navarro Schmidt D, Yunes RA, Schaab EH, Malheiros A, Cechinel Filho V, Franchi GC, Nowill AE, Cardoso AA, Yunes JA
Evaluation of the anti-proliferative effect the extracts of Allamanda blanchetti and A. schottii on the growth of leukemic and endothelial cells.
J Pharm Pharm Sci. 2006;9(2):200-8.
PURPOSE: To investigate the anti-proliferative effect of A. blanchetti and A. schottii extracts. METHODS: The anti-proliferative effect of A. blanchetti and A. schottii ethanolic extracts on K562 leukemic cells as well as on BMEC and HUVEC were evaluated. Phytochemical analysis to identify the possible active components was carried out. RESULTS: The root extract of A. schottii was the most active of them. At 80 microg/mL, the root extracts showed a cytostatic effect on K562, whereas at 400 microg/mL, there was a strong cytotoxic effect. Similar cytostatic and cytotoxic effects were seen in the endothelial cells, but at lower doses. The effect of A. schottii root extract on endothelial cells was seen at concentrations ten times lower (8 microg/mL) than the effect of the A. blanchetti root extract (80 microg/mL). Phytochemical investigation of different fractions and parts of the plant led to the isolation of several known compounds, some of which are described for the first time in the genus Allamanda, and with previous evidence of anticancer and antitumoral properties. CONCLUSIONS: Our results suggest that both plants studied exhibit cytostatic and cytotoxic activity, but the most active compounds are located in the roots. [Abstract/Link to Full Text]

Yang JJ, Zheng J, Liu HJ, Liu YX, Shen JC, Zhou ZQ
Epinephrine infiltration on nasal field causes significant hemodynamic changes: hypotension episode monitored by impedance-cardiography under general anesthesia.
J Pharm Pharm Sci. 2006;9(2):190-7.
PURPOSE: Local infiltration of epinephrine-containing local anesthetics is widely used in clinics particularly in the procedure of surgeries on vascularity field to provide good analgesia and hemostasis. A prospective randomized double blind control study was designed to observe hemodynamic changes caused by local infiltration of epinephrine- containing lidocaine solution on nasal field under general anesthesia. METHODS: 90 adult patients undergoing elective functional endoscopic sinus surgery under general anesthesia were randomly allocated into three groups and received 1% lidocaine 4 mL with different dose of epinephrine (group I 20 microg; group II 40 microg; and group III 0 microg) respectively. Mean arterial pressure (MAP), heart rate (HR), cardiac index (CI), systemic vascular resistance index (SVRI), and acceleration index (ACI) were recorded through impedance-cardiography at every 45 seconds in 6 minutes after the beginning of local infiltration. RESULTS:Compared with the intra-group baseline, statistically significant hemodynamic changes particularly decrease in MAP with increase in HR at 1.5 minutes time point (P < 0.01), and decrease in SVRI and increase in CI, ACI at and from 1.5 minutes time point (P > 0.05) were observed in group I and group II, but not in group III. CONCLUSION: Local infiltration of epinephrine-containing lidocaine solution on nasal field causes significant decrease in MAP and SVRI, and increase in HR, CI and ACI. [Abstract/Link to Full Text]

Emami J
In vitro - in vivo correlation: from theory to applications.
J Pharm Pharm Sci. 2006;9(2):169-89.
A key goal in pharmaceutical development of dosage forms is a good understanding of the in vitro and in vivo performance of the dosage forms. One of the challenges of biopharmaceutics research is correlating in vitro drug release information of various drug formulations to the in vivo drug profiles (IVIVC). Thus the need for a tool to reliably correlate in vitro and in vivo drug release data has exceedingly increased. Such a tool shortens the drug development period, economizes the resources and leads to improved product quality. Increased activity in developing IVIVCs indicates the value of IVIVCs to the pharmaceutical industry. IVIVC can be used in the development of new pharmaceuticals to reduce the number of human studies during the formulation development as the main objective of an IVIVC is to serve as a surrogate for in vivo bioavailability and to support biowaivers. It supports and/or validates the use of dissolution methods and specification settings. This is because the IVIVC includes in vivo relevance to in vitro dissolution specifications. It can also assist in quality control for certain scale-up and post-approval changes (SUPAC). With the proliferation of modified-release products, it becomes necessary to examine the concept of IVIVC in greater depth. Investigations of IVIVC are increasingly becoming an integral part of extended release drug development. There must be some in vitro means of assuring that each batch of the same product will perform identically in vivo. This review article represents the FDA guidance, development, evaluation, and validation of an IVIVC to grant biowaivers, and to set dissolution specifications for oral dosage forms, biopharmaceutics classification systems (BCS), BCS biowaivers, application of BCS in IVIVC development and concept of mapping. The importance of dissolution media and methodology and pharmacokinetic studies in the context of IVIVC has been highlighted. The review also covers the literature examples of IVIVCs regarding internal and external validation, compendial dissolution assessment, formulation dependency of IVIVCs, and IVIVCs of pure enantiomers versus racemate drugs. The same principles of IVIVC used for oral extended release products may be applied for non-oral products such as parenteral depot formulations and novel drug delivery systems as well. [Abstract/Link to Full Text]

Shahhosseini S, Guttikonda S, Bhatnagar P, Suresh MR
Production and characterization of monoclonal antibodies against shope fibroma virus superoxide dismutase and glutathione-s-transferase.
J Pharm Pharm Sci. 2006;9(2):165-8.
PURPOSE: The superoxide dismutase (SOD) like proteins encoded by Leporipoxviruses play a role in regulating the redox status of infected cells. The biological function of these proteins is unclear. Why poxviruses encode these proteins are still unknown. Exploiting standard hybridoma techniques, we developed a monoclonal antibody (MAb) against shope fibroma virus superoxide dismutase (sfvSOD) to be used in diagnostics and as tools to understand the role of SOD-like proteins in pathogenesis. METHODS: Hybridoma cell fusion technology was used for production of MAbs. Balb/c mice were immunized with sfvSOD-GST fusion protein. Hybridoma clones were screened using indirect enzyme linked immunosorbent assay (ELISA). Specificity and reactivity of the MAbs were determined by Western blot analysis (WBA) and indirect ELISA. Protein G affinity chromatography was used for the purification of MAbs. RESULTS: Two stable hybridoma clones producing MAbs against the two domains of the fusion protein were obtained. The anti-GST (glutathione-s-transferase) and anti-sfvSOD MAbs were found to react specifically with GST and sfvSOD proteins respectively, in addition to the sfvSOD-GST fusion protein. Isotypes of these MAbs were identified as IgG2b heavy chain and k light chain.CONCLUSION: The anti-sfvSOD MAb (P115.SOD MAb) has been successfully used in studying the enzymatic and biochemical properties of a SOD homolog encoded by sfv. We also developed a strong anti-GST MAb which was also cloned and characterized P115.GST MAb. The anti-GST MAb might be useful in analyzing GST fusion proteins and in immunoaffinity chromatography purification of GST fusion proteins. [Abstract/Link to Full Text]

Molavi O, Shayeganpour A, Somayaji V, Hamdy S, Brocks DR, Lavasanifar A, Kwon GS, Samuel J
Development of a sensitive and specific liquid chromatography/mass spectrometry method for the quantification of cucurbitacin I (JSI-124) in rat plasma.
J Pharm Pharm Sci. 2006;9(2):158-64.
PURPOSE: To develop a liquid chromatography/mass spectrometry (LC-MS) method for the quantitative analysis of cucurbitacin I (JSI-124), an anti-cancer inhibitor of the janus kinase 2/signal transducer and activator of transcription 3 (JAK2/STAT3) signaling pathway, in rat plasma samples. METHODS: Standard samples of cucurbitacin I were prepared from a stock solution (1 mg/mL) in methanol. Internal standard (I.S.) was 4-hydroxybenzophenone. Extraction of cucurbitacin I and I.S. from rat plasma was performed using acetonitrile/dichloromethane. LC-MS analyses were performed using a Waters Micromass ZQ 4000 spectrometer, and chromatographic separation was achieved using a Waters XTerraMSC18 3.5 microm (2.1 x 50 mm) column as the stationary phase. The mobile phase consisting of a mixture of acetonitrile: water containing 1% formic acid with initial ratio of 20:80, employing a linear gradient to a final ratio of 40:60 v/v over 13 minutes, was delivered at a constant flow rate of 0.2 mL/min. The mass spectrometer was operated in negative ionization mode and analytes were quantified with single ion recording (SIR) at m/z 559 for cucurbitacin I and m/z 196.8 for I.S. RESULTS: Calibration curves with r2 > 0.999 were constructed over the concentration range of 5-10000 ng/mL for the solution of cucurbitacin I in methanol and 10-1000 ng/mL for rat plasma samples. The extraction recoveries were 86 and 98% for 50 ng/mL and 1000 ng/mL plasma concentration of cucurbitacin I, respectively. The intra- and inter-day coefficients of variation were less than 15%, and mean intraday errors were less than 10% at plasma concentration extending from 10-1000 ng/mL. CONCLUSION: The developed assay is sensitive, specific, reproducible and reliable for quantitative analysis of cucurbitacin I. Application in a pharmacokinetic assessment was proven in the rats given the drug. [Abstract/Link to Full Text]

Awad A, Al-Ebrahim S, Abahussain E
Pharmaceutical care services in hospitals of Kuwait.
J Pharm Pharm Sci. 2006;9(2):149-57.
PURPOSE: To describe the current pharmacy practice in the general public hospitals based on self-reported practice by pharmacists, explore the awareness of the pharmacists of pharmaceutical care concept, identify their willingness to implement pharmaceutical care practice, and identify the barriers that may limit its implementation. METHODS: Eighty hospital pharmacists working in four general public hospitals were approached to be included in the study. Data were colleted via face-to-face structured interview of the respondents using a pre-tested questionnaire. RESULTS: The response rate was 76.3%. Thirty five (57.4%) of the respondents had frequently performed interventions on prescriptions through interaction with physicians. Thirty two (52.5%) had frequently provided patient counselling. The knowledge of the respondents about the counseling points for salbutamol inhaler was assessed using a total score of 10, 35 (57.4%) scored = 5. The frequent provision of counseling was non-significantly least common among the > 40 years group compared to youngest age group (OR: 0.7, 0.3-1.9), male gender (0.6, 0.2-1.4) and those with a practice experience of > 20 years (0.4, 0.1-1.2). Forty six (75.4%) of the respondents reported that they were aware of pharmaceutical care concept. Thirty five (76.1%) and 39.1% of those who reported awareness of pharmaceutical care concept indicated that its main focus is the patient and the appropriate objectives of the concept, respectively. The awareness about the patient as the main focus of pharmaceutical care was non-significantly least among the respondents aged 41-60 years (OR: 0.6, 0.2-2.4) and those with a practice experience of 21-40 years (0.3, 0.1-1.0). The main barriers perceived by the participants were lack of time (78%) and lack of staff (71.2%). CONCLUSION: The current practice of hospital pharmacists in Kuwait needs further improvement in relation to interaction with physicians and patient counselling. The lack of uniformity in the responses regarding the focus and objectives of pharmaceutical care indicates a lack of appropriate understanding in this matter. All respondents have shown high willingness towards the implementation of pharmaceutical care services in their practice. [Abstract/Link to Full Text]

Peng YW, Chi L, Gibson G, Janiczek N, Juneau P, Ross D, A Perrin L, Leadley R
Formulation modifications of PD 0313052, a direct Factor Xa Inhibitor, alter pharmacokinetics and pharma-codynamics following subcutaneous administration to rabbits.
J Pharm Pharm Sci. 2006;9(2):140-8.
PURPOSE: PD 0313052 is a potent, direct factor Xa (FXa) inhibitor (Ki = 0.33 nM) and its antithrombotic effect has been previously demonstrated in several animal models, via intravenous (IV) administration. In the present study, we evaluated four different subcutaneous (SC) formulations to test the feasibility of developing PD 0313052 as a subcutaneous agent. METHODS: PD 0313052 was formulated in saline, methylcellulose (MC, 0.5% methylcellulose solution containing 1% Tween-80), sesame oil, and F127 (25% aqueous solution). Each formulation was injected subcutaneously into rabbits and the relative plasma exposure and the duration of action of PD 0313052 were assessed. Plasma concentration, FXa activity, and coagulation parameters were used to monitor the pharmacokinetic (PK) and pharmacodynamic (PD) profiles of PD 0313052. RESULTS: Regardless of formulation, there was a significant (p < 0.05) correlation between PD 0313052 plasma concentration and FXa activity (R2 = 0.90), prothrombin time (PT) (R2 = 0.86), and Heptest (R2 = 0.93). The saline and MC formulations had similar effects on FXa activity, coagulation parameters, and Heptest, peaking at 30 to 120 minutes after administration and decreasing rapidly thereafter. In contrast, formulations of F127 and sesame oil yielded lower maximal effects on PD markers but produced sustained PD effects over time. CONCLUSION: The data indicate that PD 0313052 is bioavailable after SC administration to rabbits and that there is a strong correlation between the PD parameters and plasma concentrations of PD 0313052. Modifications in the formulation of PD 0313052 produce marked differences in the PK and PD profiles of this agent after SC administration to rabbits. These results suggest that SC formulations can be optimized to improve the PK and PD profiles of PD 0313052, and that PD 0313052 is a viable candidate for development as a SC antithrombotic agent. [Abstract/Link to Full Text]

Yasuda S, Itagaki S, Hirano T, Iseki K
Effects of sex hormones on regulation of ABCG2 expression in the placental cell line BeWo.
J Pharm Pharm Sci. 2006;9(1):133-9.
PURPOSE: The aim of this study was to elucidate the effects of sex hormones that are secreted during gestation from the placenta on ABCG2 mRNA and protein expression levels by using the placental cell line BeWo. METHODS: We investigated the effects of estrogens (estrone, 17-beta-estradiol and estriol) on the expression level of ABCG2 mRNA by RT-PCR. The expression level of ABCG2 protein was analyzed by Western blot analysis. We also investigated the localization of ABCG2 in BeWo cells by Western blot analysis of the plasma membrane fraction and by immunohistochemistry. RESULTS: It was found that all estrogens induce the expression of ABCG2 mRNA in a concentration-dependent manner. Furthermore, Western blot analysis showed that 17-beta-estradiol induces the expression of ABCG2 protein. Western blot analysis of the plasma membrane fraction and immunohistochemistry showed that ABCG2 localized on only the apical side of BeWo cells and that 17-beta-estradiol had no effect on the localization of ABCG2. In addition, progesterone suppressed the induction of ABCG2 expression by 17-beta-estradiol at 1-10 microM. CONCLUSION: The expression of ABCG2 in the placenta is regulated by estrogen and progesterone during gestation. [Abstract/Link to Full Text]

Azarmi S, Huang Y, Chen H, McQuarrie S, Abrams D, Roa W, Finlay WH, Miller GG, L�benberg R
Optimization of a two-step desolvation method for preparing gelatin nanoparticles and cell uptake studies in 143B osteosarcoma cancer cells.
J Pharm Pharm Sci. 2006;9(1):124-32.
PURPOSE: To establish a matrix of parameters to synthesize nanoparticles of different sizes and to investigate the cellular uptake of these nanoparticles by osteosarcoma cancer cells in order to investigate their potential as therapeutic drugdelivery carriers. METHODS: Gelatin A and B were used to synthesize nanoparticles by a two-step desolvation process. Different parameters were investigated, including temperature, pH, concentration of glutaraldehyde, type of desolvating agent and nature of gelatin. For cell uptake studies, Texas Red labeled nanoparticles were incubated with 143B osteosarcoma cells and then evaluated using confocal laser scanning microscopy (CLSM). RESULTS: The systematic investigation of the synthesis parameters showed that it is possible to prepare gelatin-based nanoparticles with different particle sizes and a narrow size distribution. Temperature and nature of the gelatin were the most important synthesis factors. Bioimaging using CLSM showed uptake of the nanoparticles by 143B osteosarcoma cancer cells. CONCLUSIONS: Osteosarcoma cancer cells take up gelatin nanoparticles. This might improve the clinical effectiveness of anti-cancer treatments if nanoparticles are used as a drug delivery system and has important implications for future cancer treatment strategies. [Abstract/Link to Full Text]

Karimi G, Fatehi Z, Gholamnejad Z
The role of nitric oxide and protein kinase C in lipopolysaccharidemediated vascular hyporeactivity.
J Pharm Pharm Sci. 2006;9(1):119-23.
PURPOSE: Overactivation of nitric oxide and protein kinase C (PKC) pathway has been reported to play a role in the pathogenesis of vascular hyporesponsiveness of endotoxic shock. In this study we investigated the role of nitric oxide and PKC in lipopolysaccharide (LPS) mediated vascular hyporeactivity. METHODS: Contraction to phenylephrine and endothelium-dependent and independent vasodilation in the presence and absence of a nonspecific NO inhibitor (L-NAME) and potent PKC inhibitor (chelerythrine) were examined. RESULTS: In LPS treated rats, contractile response of aortic rings to phenylephrine and relaxation in response to acetylcholine were reduced, but relaxation induced by sodium nitroprusside remained unchanged. The attenuation of contractile response to phenylephrine in the presence of L-NAME and chelerythrine was more pronounced in aortic ring isolated from LPS treated rats than control. L-NAME decreased acetylcholine -dependent vasodilation in both group but it was more pronounced in LPS treated rats. Chelerythrine pretreatment improved maximal relaxation to acetylcholine in aortic ring isolated from LPS treated rats. CONCLUSION: These data indicate that the vascular hyporesponsiveness to phenylephrine and acetylcholine after treatment with LPS may be related to an enhanced NO production in the smooth muscle cells and PKC plays a role as an intracellular mediator of LPS-induce NOS activity and vascular suppression. [Abstract/Link to Full Text]

Mehvar R
Interdependency of pharmacokinetic parameters: a chicken-and-egg problem? Not!
J Pharm Pharm Sci. 2006;9(1):113-8.
Pharmacokinetic (PK) software packages are widely used by scientists in different disciplines to estimate PK parameters. However, their use without a clear understanding of physiological parameters affecting the PK parameters and how different PK parameters are related to each other may result in erroneous interpretation of data. Often, mathematical relationships used for the estimation of PK parameters obscure the true physiological relationships among these parameters, prompting a discussion of which parameter came first and giving the appearance of the-chicken-and-the-egg dilemma. In this article, the author attempts to show how different PK parameters are related to physiological parameters and each other by using various scenarios and examples. In particular, the relationship between clearance and the rate of elimination and that among the other major PK parameters are explored. It is concluded that there is no dilemma in interdependency of the PK parameters, and the relationships among the PK parameters and between PK and physiological parameters are clear. [Abstract/Link to Full Text]

Takekuma Y, Takenaka T, Kiyokawa M, Yamazaki K, Okamoto H, Kitabatake A, Tsutsui H, Sugawara M
Contribution of polymorphisms in UDP-glucuronosyltransferase and CYP2D6 to the individual variation in disposition of carvedilol.
J Pharm Pharm Sci. 2006;9(1):101-12.
PURPOSE: It has been reported that carvedilol, which has beta-adrenergic blocking and vasodilating activities, is mainly metabolized by UDP-glucuronosyltransferase (UGT) 1A1, UGT2B4, UGT2B7 and CYP2D6. The aim of this study was to determine whether the activity of glucuronidation has an influence on the area under the curve (AUC) of carvedilol and whether polymorphisms in UGTs and CYP2D6 contribute to individual variation in disposition of carvedilol in Japanese. METHODS: Plasma concentrations of carvedilol and its glucuronide were determined by reversed-phase high-performance liquid chromatography (HPLC). Genotyping of UGT1A1, UGT2B4 and UGT2B7 genes was carried out by the direct sequence method. CYP2D6 genotyping was carried out using an amplification refractory mutation system (ARMS) assay and PCR-restriction fragment length polymorphism (RFLP). RESULTS: The level of carvedilol glucuronidation ability in the high-level AUC group was significantly lower than that in the low-level group. The frequencies of UGT1A1*6, UGT2B7*3 and CYP2D6*10 in the low level ability of glucuronidation group were significantly higher than those in the high level group, and the same tendency was found in the frequency of CYP2D6*5, though there was no significant difference. CONCLUSION: Polymorphisms of UGT1A1, UGT2B7 and CYP2D6 strongly affect the pharmacokinetics and disposition of carvedilol in Japanese. [Abstract/Link to Full Text]

Zhao B, Moochhala SM, Lu J, Tan D, Lai MH
Determination of pyridostigmine bromide and its metabolites in biological samples.
J Pharm Pharm Sci. 2006;9(1):71-81.
Pyridostigmine bromide (PB) is a quartenary ammonium compound that inhibits the hydrolysis of acetylcholine by competitive reversible binding to acetylcholinesterase. PB is used for the symptomatic treatment of myasthenia gravis and has been applied as a prophylaxis against nerve agents. Many studies on PB have involved the reliance on techniques that extract and quantify PB in biological samples. This article presents an overview of the currently applied methodologies for the determination of PB and its metabolites in various biological samples. Articles published from January 1975 to the July 2005 were taken into consideration for the discussion of the metabolism and analytical method of PB. HPLC and GC methods have been used and discussed in most of the references cited in this review. Other methods such as RIA and CE that have been recently reported are also mentioned in this article. Basic information about the type of sample used for analysis, sample preparation, chromatographic column, mobile phase, detection mode and validation data are summarized in a table. [Abstract/Link to Full Text]

Mao ZL, Tam YK, Coutts RT
Effect of protein and calorie malnutrition on drug metabolism in rat - in vitro.
J Pharm Pharm Sci. 2006;9(1):60-70.
PURPOSE: To study the effect of protein and calorie malnutrition on in vitro drug metabolism of protein and calorie malnourished juvenile and adult rats. METHOD: Microsomal incubation was used as a means of monitoring drug metabolism changes, HPLC was employed to quantify metabolites and enzyme immunoassay (EIA) was used for rat growth hormone (rGH) monitoring. RESULTS: Protein and calorie malnutrition significantly decreased levels of microsomal protein and total P450. Microsome of protein and calorie malnourished rats showed impaired testosterone 16alpha- and 2alpha- hydroxylation (CYP2C11), testosterone 6beta-hydroxylation (CYP3A), and testosterone 7alpha-hydroxylation (CYP2A1). Testosterone 16beta-hydroxylation (CYP2B1) did not show any significant change, neither in capacity nor affinity. The quantity and the secretion pattern of rGH were not altered in protein and calorie malnourished rats compared to those in healthy animals. CONCLUSIONS: Serum albumin is not a good indicator of malnutrition. The capacity and affinity of CYP2C11, CYP3A and CYP2A1 were compromised by protein and calorie malnutrition. The impairment of drug metabolism in protein and calorie malnourished rats was not caused by the alteration of rGH. [Abstract/Link to Full Text]

Rohra DK, Gilani AH, Memon IK, Perven G, Khan MT, Zafar H, Kumar R
Critical evaluation of the claims made by pharmaceutical companies in drug promotional material in Pakistan.
J Pharm Pharm Sci. 2006;9(1):50-9.
BACKGROUND: In Pakistan, there is no mechanism to monitor the drug promotional campaign by pharmaceutical industry despite the fact that there is enough evidence that irrational pharmacotherapy is increasingly encountered even in the developed countries due to unethical practices of pharmaceutical promotion. Objectives. To audit the drug promotional claims made by the pharmaceutical companies in Pakistan. METHODS: Drug promotional pamphlets and brochures containing claims for the drugs, which were circulated by the pharmaceutical representatives were collected from 122 general practitioners (GPs) from Karachi and Larkana cities of the Sindh Province. The claims were critically analyzed and audited with the help of currently available evidence in the medical literature. RESULTS: 345 distinct advertisements covering 182 drugs from different manufacturers were critically analyzed for information content. Sixty two out of 345 (18%) of the reviewed advertisements were adjudged to be misleading / unjustifiable, which were again classified as, exaggerated (32%), ambiguous (21%), false (26%), and controversial (21%). The primary source of information (approximately 78%) about the newly launched drugs for the GPs was found to be the pharmaceutical representatives followed by hospital doctors (5%) and colleagues (5%). Furthermore, 110 (90%) GPs were of the view that the drug promotion has definitely an influence on their prescribing pattern. CONCLUSIONS: Since GPs in Pakistan rate pharmaceutical companies as their primary source of information regarding drugs, it can be anticipated that inappropriate advertisement claims would lead to irrational prescribing if physicians had no any other information to follow. [Abstract/Link to Full Text]

L�benberg R, Steinke W
Investigation of vitamin and mineral tablets and capsules on the Canadian market.
J Pharm Pharm Sci. 2006;9(1):40-9.
PURPOSE: The goal of this study was to investigate the disintegrating properties of tablets and capsules containing minerals and vitamins commercially available on the Canadian market and to review their label information. METHODS: The labels were examined for product-related information. The first disintegration test stage was performed using Simulated Intestinal Fluid (SIF) pH 6.8 for 20 minutes. Products which did not disintegrate were further investigated using USP disintegration conditions for dietary supplements. RESULTS: The provided label information is difficult to understand and in some cases pseudo-scientific. Thirty out of thirty-nine tablets and six out of ten capsules had a Drug Identification Number (DIN). Twenty-one of thirty-nine tablets and four out of the ten capsules did not disintegrate within 20 minutes. Using the USP disintegration conditions for dietary supplements nine tablet products did not fully disintegrate but all capsules passed the test. None of the three "time-released" products disintegrated under the applied conditions. CONCLUSIONS: Industry should follow already existing label recommendations more closely to allow the consumers to make an informed decision on their products by providing only essential information rather than using pseudo-scientific terms. The results of the disintegration study indicated that disintegration, one of the most basic quality control parameters, is still a concern for dietary supplements. [Abstract/Link to Full Text]

Tirumalasetty PP, Eley JG
Permeability enhancing effects of the alkylglycoside, octylglucoside, on insulin permeation across epithelial membrane in vitro.
J Pharm Pharm Sci. 2006;9(1):32-9.
PURPOSE: To evaluate the permeability enhancing effects of octylglucoside (OG) for molecules with poor absorption such as insulin by in vitro cell models. METHODS: Transepithelial electrical resistance (TEER) was monitored to ensure monolayer integrity. Permeability was ascertained using paracellular markers. Markers and insulin were dissolved in Hanks balanced salt solution and placed on the apical side of the cells in Transwell(c) plates and allowed to diffuse under sink conditions. RESULTS: The effect of OG on the permeability of molecules across both monolayers was concentration and time dependent. Enhanced transport of the three molecules was observed across both monolayers treated with OG as compared to untreated monolayers. The effects of OG were reversible at low concentrations but there was permanent damage to cells at higher concentrations. Absorption enhancement was greater across T-84 monolayers compared to Caco-2 monolayers. CONCLUSIONS: The results indicate OG has potential as a permeability enhancer for poorly absorbed drugs with no significant damage to monolayers at low concentrations. Immediate attenuation in TEER upon exposure to OG indicates that permeability enhancing effects were likely to be associated with modulation of tight junctions suggesting the involvement of paracellular transport. [Abstract/Link to Full Text]

Dora CL, Alvarez-Silva M, Trentin AG, de Faria TJ, Fernandes D, da Costa R, Stimamiglio M, Lemos-Senna E
Evaluation of antimetastatic activity and systemic toxicity of camptothecin-loaded microspheres in mice injected with B16-F10 melanoma cells.
J Pharm Pharm Sci. 2006;9(1):22-31.
PURPOSE: The aim of this work was to evaluate the pulmonary antimetastatic activity and the systemic toxicity of camptothecin-loaded microspheres. METHODS: PCL microspheres containing camptothecin (CPT) were prepared by the emulsion solvent/evaporation method and characterized according to their encapsulation efficiency, particle size, morphology, and drug release. The ability of CPT to inhibit the lung metastasis was verified using an experimental mouse model intravenously injected with metastatic B16- F10 melanoma cells. The microspheres and the free drug were given intraperitoneally at a dose of 7 mg/kg at intervals of three or five days for 24 days. The systemic toxicity of CPT was evaluated by weight measurements, survival and hemograms of the animals. RESULTS: The encapsulation efficiency was nearly 80%. The drug release was complete after 72 hours, but the burst effect increased from 7% to 35% with the increase in CPT content in the particles. It was observed during the in vivo essays that all groups treated with CPT had a decrease of nearly 70% in the number of lung metastases. However, systemic toxicity was verified in animals that received the free drug. CONCLUSION: Camptothecin-loaded microspheres demonstrated similar therapeutic efficacy when compared to those of the free drug, but the toxicity was significantly reduced. [Abstract/Link to Full Text]

Kim JY, Kim YC, Lee MG, Kwon JW, Yoo M
Effects of water deprivation on the pharmacokinetics of DA-8159, a new erectogenic, in rats.
J Pharm Pharm Sci. 2006;9(1):10-21.
PURPOSE: To test the effect of 72 h water deprivation on the non-renal clearance (CL) of DA-8159 in a rat model of dehydration. DA-8159 is mainly metabolized via CYP3A1/2 and the expression and mRNA level of CYP3A1/2 are not affected by dehydration. METHODS: DA-8159 (30 mg/kg) was administered intravenously or orally to male control Sprague Dawley rats and rat model of dehydration. RESULTS: As expected, after intravenous administration, the CL(NR) values of DA-8159 were comparable between two groups of rats. This could be supported by comparable intrinsic CL of DA-8159 using hepatic microsomes for both groups of rats. However, the CL was significantly slower in rat model of dehydration due, at least in part, to significantly slower renal CL in rat model of dehydration. The slower CL(R) in rat model of dehydration could be due to urine flow ratedependent renal CL of DA-8159; the less urine output, the less the urinary excretion of unchanged DA-8159. After oral administration, the AUC values of DA-8159 were not significantly different between two groups of rats, although the AUC of DA-8159 in rat model of dehydration was significantly greater than controls after intravenous administration. This could be possibly due to changes in the intestinal first-pass effects in rat model of dehydration. CONCLUSIONS: After intravenous administration of DA-8159, the non-renal CL values were comparable between two groups of rats due to the lack of effect of dehydration on CYP3A1/2. [Abstract/Link to Full Text]

Liu AH, Lin YH, Yang M, Sun JH, Guo H, Guo DA
High-performance liquid chromatographic determination of tanshinones in the roots of Salvia miltiorrhiza and related traditional chinese medicinal preparations.
J Pharm Pharm Sci. 2006;9(1):1-9.
PURPOSE: This paper describes a validated high-performance liquid chromatographic method to quantitate four tanshinones as markers; dihydrotanshinone I, cryptotanshinone, tanshinone I and tanshinone IIA for use in the quality control of the roots of Salvia miltiorrhiza and its related traditional Chinese medicinal preparations. METHODS: Separation was achieved using a Zorbax Extend C18 reserved-phase column (5microm, 250*4.6mm) at 20 degrees with a gradient mixture of deionized water and acetonitrile at a flow rate of 1.2ml/min. RESULT: The limits of quantitation were 0.13, 0.08, 0.06 and 0.05microg/ml for dihydrotanshinone I, cryptotanshinone, tanshinone I and tanshinone IIA, respectively. This method provided good reproducibility and sensitivity for the quantification of four tanshinones with overall RSD values for intra-day and inter-day precision and accuracy better than 3.8% and higher than 94.9%, respectively. The recovery of the method was 95.4-104.4% for all the tanshinones and showed good linearity (r>0.9998) over a relatively wide concentration range. CONCLUSIONS: This assay was successfully applied to the determination of four tanshinones in the roots of Salvia miltiorrhiza and its related traditional Chinese medicinal preparations. The results indicated that the HPLC assay could be readily utilized as a quality control method for the roots of Salvia miltiorrhiza and its related traditional Chinese medicinal preparations. [Abstract/Link to Full Text]

Kulmatycki KM, Jamali F
Drug disease interactions: role of inflammatory mediators in disease and variability in drug response.
J Pharm Pharm Sci. 2005;8(3):602-25.
Expression of both pro- and anti-inflammatory mediators are influenced by various factors such as rheumatic diseases, myocardial infarction, angina, aging, obesity and pharmacotherapy. This has therapeutic consequences. Clearance of highly bound and efficiently metabolized drugs may be reduced in the presence of inflammation amounting to increased circulating drug concentration. In the meantime, various cardiovascular receptors are down-regulated in the presence of pro-inflammatory mediators. Consequently, conditions such as rheumatoid arthritis, aging and obesity results in reduced response to drugs such as verapamil despite increased drug concentration. The inflammatory response is a complex cascade of non-specific events resulting in excessive generation of inflammatory mediators such as cytokines, C-reactive protein and nitric oxide by cells of the innate (macrophages, monocytes, neutrophils) and adaptive (T-lymphocytes) arms of the immune system. T-lymphocytes secrete various pro- and anti-inflammatory cytokines during an inflammatory event. In general, two distinct subpopulations of these T-helper cells exist, anti-inflammatory Th2 and pro-inflammatory Th1. As a common rule, Th1 cytokines suppress Th2 and vice-versa. Hence, a balance of these activities is desired. Drugs such as antirheumatoid agents, angiotensin II blockers and hydroxymethyl-glutaryl-CoA reductase inhibitor (statin) may help to restore the Th1/Th2 balance. In general, at least for some conditions, the challenge of therapeutic drug monitoring will be more useful if expression of inflammatory mediators is also taken into account. In addition, some of the intersubject variation in pharmacotherapy and clinical trails may be attributed to variations in the inflammatory mediator's concentration. A detail list of conditions and drugs that influence expression of the inflammatory mediators are provided and potential therapeutic consequences are discussed. [Abstract/Link to Full Text]

Choisnard L, G�ze A, Bigan M, Putaux JL, Wouessidjewe D
Efficient size control of amphiphilic cyclodextrin nanoparticles through a statistical mixture design methodology.
J Pharm Pharm Sci. 2005;8(3):593-601.
PURPOSE: the aim of the study was to investigate size control of amphiphilic beta-cyclodextrin nanoparticles obtained by solvent displacement technique. METHODS: An experimental design methodology for mixture design was undertaken using D-optimal approach with the following technique variables: water fraction X1 (40-70% v/v), acetone fraction X2 (0-60% v/v) and ethanol fraction X3 (0-60% v/v). RESULTS: The resulting quadratic model obtained after logarithmic transformation of data and partial least-square regression was statistically validated and experimentally checked. Also, the morphology of the colloidal nanoparticles from selected experiments was observed by cryo-transmission electron microscopy. CONCLUSIONS: This experimental design approach allowed to produce interesting amphiphilic beta-cyclodextrin nanoparticles with a predicted mean size varying from 60 to 400 nm. [Abstract/Link to Full Text]

Carrasco R, Padr�n JA, P�rez R, Rodr�quez H, Su�rez M, Ochoa C
Quantitative structure antitumoral-activity relationships of thiadiazinthione derivatives using the novel hybrid molecular index pMRchi.
J Pharm Pharm Sci. 2005;8(3):586-92.
PURPOSE: The recently defined molar-refractivity-partition index was applied to a family of 1,3,5- thiadiazin-2-thione derivatives in order to establish quantitative structure-antitumoral models. The goal of this effort is to establish the relationships between the structure and biological response of these compounds. METHOD: After the splitting of the sample in two sets, their indices were correlated against the measured biological activity. The combined use of our index with others had been able to describe not only the topologic but also the London dispersive forces of any fragment in relation to the biological response of the sets. RESULTS: The obtained models showed correlation coefficients of 0.87 and 0.81 respectively linking structural and biological features of the molecules. The mean relative error values were less than 7%. According to the models, the activity of the first sample is related mostly to molecular topology and dispersive forces. Sample two activity was associated to the size and branching of the substituents, and also to the London forces. CONCLUSION: The index was able to discriminate between pure topological features and those related to dispersive forces. [Abstract/Link to Full Text]

Seebacher W, Weis R, Kaiser M, Brun R, Saf R
Synthesis of 2-azabicyclo[3.2.2]nonanes from bicyclo[2.2.2]octan-2-ones and their activities against Trypanosoma brucei rhodesiense and Plasmodium falciparum K1.
J Pharm Pharm Sci. 2005;8(3):578-85.
PURPOSE: New 2-azabicyclo[3.2.2]nonanes were prepared from antiprotozoal bicyclo[2.2.2]octan-2-ones to investigate the influence of the replacement of the rigid bicyclo-octane structure by the more flexible bicyclo-nonane system on the antiplasmodial and antitrypanosomal activity. METHODS: The 2-azabicyclo[3.2.2]nonanes were synthesized via a one-step procedure from bicyclo[2.2.2]octan-2-ones and tested for their activities against Trypanosoma b. rhodesiense and Plasmodium falciparum K1 (resistant to chloroquine and pyrimethamine) using in vitro microplate assays. RESULTS: 2-azabicyclo[3.2.2]non-5-ylamines exhibit higher antiprotozoal activities than 4-aminobicyclo[2.2.2]octanes, 4-aminobicycl [2.2.2]octan-2-ones and 4-amino-2-azabicyclo[3.2.2]nonan-3-ones. (7, 8-Diphenyl-2-azabicyclo[3.2.2]non-5-yl)-dimethylamine shows enhanced anti-trypanosomal (IC50 = 0.60 microM) and remarkable antiplasmodial (IC50 = 0.28 microM) activity. However, the in vivo activity of this compound against Plasmodium berghei in mice is moderate. CONCLUSIONS: Due to their promising in vitro antiprotozoal activity and their low cytotoxicity, 2-azabicyclo[3.2.2]nonanes should serve as lead compounds for further modifications. [Abstract/Link to Full Text]

Sriram D, Bal TR, Yogeeswari P
Aminopyrimidinimino isatin analogues: design of novel non- nucleoside HIV-1 reverse transcriptase inhibitors with broad-spectrum chemotherapeutic properties.
J Pharm Pharm Sci. 2005;8(3):565-77.
PURPOSE: HIV is the most significant risk factor for many opportunistic infections such as tuberculosis, hepatitis, bacterial infections and others. In this paper, we describe an aminopyrimidinimino isatin lead compound as a novel non-nucleoside reverse transcriptase inhibitor with broad-spectrum chemotherapeutic properties for the effective treatment of AIDS and AIDS-related opportunistic infections. METHODS: The synthesis of various aminopyrimidinimino isatin derivatives was achieved in two steps and evaluated for anti-HIV, anti-HCV, antimycobacterial and antibacterial activities. RESULTS: Compound 1-cyclopropyl-6-fluoro-1,4-dihydro-4-oxo-7[[N4-[3'-(4'-amino-5'-trimethoxybenzylpyrimidin-2'-yl)imino-1'-isatinyl] methyl]N1-piperazinyl]-3-quinoline carboxylic acid (14) emerged as the most potent broad-spectrum chemotherapeutic agent active against HIV, HCV, M. tuberculosis and various pathogenic bacteria. Among the synthesized compounds compound 14 and 15 emerged as more promising broad-spectrum chemotherapeutic agents. [Abstract/Link to Full Text]

Chattopadhyay D, Arunachalam G, Ghosh L, Rajendran K, Mandal AB, Bhattacharya SK
Antipyretic activity of Alstonia macrophylla Wall ex A. DC: an ethnomedicine of Andaman Islands.
J Pharm Pharm Sci. 2005;8(3):558-64.
PURPOSE: Alstonia macrophylla Wall ex A. DC. Leaf, used in different ailments by the Onge tribes of Little Andaman Island, India, was investigated for its antipyretic potential. METHODS: The methanol extract and its fractions were tested on normal body temperature and yeast-induced pyrexia in Wistar Albino rats. RESULTS: The leaf extract at oral doses of 200 and 300 mg/kg, and the n-butanol fractions of the extract at 50 mg/kg showed significant reduction in normal body temperature and yeast-provoked elevated temperature in a dose-dependent manner comparable to that of standard antipyretic drug paracetamol. The antipyretic effect was started at 1 h and extended for at least 5 h after the drug administration. CONCLUSIONS: The antipyretic effect was more pronounced when the fraction A and B was administered together, indicating that both the fractions may contain antipyretic compounds which produce an additive effect in combination. Phytochemically these fractions contain beta-sitosterol and ursolic acid. [Abstract/Link to Full Text]

Balogh J, Bubenik J, Dred�n J, Csempesz F, Kiss D, Zelk� R
The effect of structured triglycerides on the kinetic stability of total nutrient admixtures.
J Pharm Pharm Sci. 2005;8(3):552-7.
PURPOSE: The physical stability of two types of total parenteral nutrient (TPN) admixtures was studied as a function of storage time and temperature. One of them contained only structured triglycerides and the other exclusively long-chain triglycerides as lipid components. METHODS: Droplet size of the mixtures was followed by photon correlation spectroscopy for 10 days. Zeta potential and dynamic surface tension measurements were carried out to evaluate the possible changes in the charge and interfacial surface tension of the emulsion droplets during the storage. pH values were monitored in order to follow the possible decomposition processes in the course of storage. RESULTS: Droplet size of emulsions prepared with lipids containing exclusively long-chain triglycerides showed remarkable increase after 4 days of storage in contrast with that of the mixtures containing structured lipids. CONCLUSIONS: The obtained results indicate that besides the advantageous metabolic effects of structured triglycerides, their application is recommended to improve the physical stability of TPN admixtures. [Abstract/Link to Full Text]

Yamamura S, Takehira R, Kawada K, Katayama S, Nishizawa K, Hirano M, Momose Y
Structural equation modeling of qualification of pharmacists to improve subjected quality of life in cancer patients.
J Pharm Pharm Sci. 2005;8(3):544-51.
PURPOSE: To establish structural equation model (SEM) of subjected quality of life (QOL) in cancer patients taking into account qualification of pharmacists. METHOD: The SEM model was constructed from correlation matrix of the scores of answers of questions to both patients and pharmacists. Data were collected from 15 cancer patients who hospitalized and took opioid analgesics for pain control. The patients were asked 18 questions and pharmacists were asked seven questions. From the correlation matrix among scores of answers, a reasonable model was explored by SEM. RESULTS: Health-related QOL (HRQOL) in cancer patients can be modeled by latent variables consist of contributions from physical, emotional and functional domains. The fitting between data and the model was acceptable by statistical goodness-of-fit (GOF) index. The modeled HRQOL by SEM was weakly correlated with subjected QOL in patients, indicating that subjected QOL in patients would be affected not only by above latent variables but other variables. The model taking into account qualification of pharmacists to improve subjected QOL in patients was also made by SEM. The model was reasonably explained and fitting between data and the model was acceptable from some statistical index. The final model suggests that pharmacist can raise subjected QOL in patients through restraining unpleasant side effects. CONCLUSION: The qualification of pharmacists to improve subjected QOL in patients can be modeled by SEM. The final model suggests that pharmacists with qualification to assess patients' pain status contribute to raise subjected quality of life in cancer patients. [Abstract/Link to Full Text]

Recent Articles in Journal of Drug Targeting

No recent articles are currently available.

Recent Articles in Drug Metabolism and Pharmacokinetics

Yamazaki H, Tanaka K, Gamura S, Hashimoto T, Shimizu M
High-performance liquid chromatographic assay for carboplatin in ultrafiltered plasma combined with hyperbaric oxygenation.
Drug Metab Pharmacokinet. 2006 Oct;21(5):429-31.
A specific, sensitive and reproducible high-performance liquid chromatographic procedure was developed for the quantitative analysis of carboplatin in human plasma. Plasma was ultrafiltered with an Amicon Centrifree system and then injected onto an analytical NH2 column. Carboplatin was monitored at 230 nm and eluted by 10 min using acetonitrile/methanol/5 mM sodium perchlorate buffer (pH 2.4) (75:15:10, v/v) as a mobile phase. The method yielded intra-day and inter-day precision and accuracy of <6% with a linearly from 0.1 to 80 microg/mL and a recovery of >98%. Plasma concentrations of intravenously administered carboplatin in three patients could be determined by this system. Slightly higher plasma concentrations of carboplatin were detected even 30 min after hyperbaric oxygenation therapy for 60 min than expected. The results suggest that this method could be applicable for measurement of carboplatin in plasma samples to evaluate carboplatin therapy together with hyperbaric oxygenation. [Abstract/Link to Full Text]

Iida A, Tomita M, Idota Y, Takizawa Y, Hayashi M
Improvement of intestinal absorption of P-glycoprotein substrate by D-tartaric acid.
Drug Metab Pharmacokinet. 2006 Oct;21(5):424-8.
The purpose of the present experiment was to examine the effects of D-tartaric acid (TA) on intestinal drug absorption under both in situ and in vitro experimental conditions. In the in vitro diffusion chamber experiments, TA (10 mM) added to the mucosal side of rat colon significantly decreased rhodamine123 (Rho 123) transport from the serosal to mucosal side. Since TA has been shown to change the integrity of the epithelial tight junctions in rat colon at low pH conditions, resulting in improved paracellular drug transport, the effect of TA on membrane resistance was examined at pH 7.4 in the present study. It was found that membrane resistance, an indicator of paracellular integrity, did not change at pH 7.4. In the in situ loop method, TA (20 mM) increased the absorption of Rho123 in both ileum and colon but not in jejunum. TA (20 mM) also increased the absorption of daunorubicin in the ileum, but TA (20 mM) did not change the expression level of P-glycoprotein (P-gp). TA (20 mM) significantly inhibited excretion of i.v.-administered Rho123 and daunorubicin into the ileal lumen. In conclusion, for the first time we demonstrated that TA increases the intestinal absorption of P-gp substrates Rho123 and daunorubicin, possibly by modulating the P-gp function without changing the expression level of P-gp in the rat intestine. [Abstract/Link to Full Text]

Shirasaka Y, Kawasaki M, Sakane T, Omatsu H, Moriya Y, Nakamura T, Sakaeda T, Okumura K, Langguth P, Yamashita S
Induction of human P-glycoprotein in Caco-2 cells: development of a highly sensitive assay system for P-glycoprotein-mediated drug transport.
Drug Metab Pharmacokinet. 2006 Oct;21(5):414-23.
The aim of this work is to develop a highly sensitive assay system for P-gp-mediated transport by using two methods, induction of P-gp and short-term culture of Caco-2 cells. To induce P-gp in Caco-2 cells, cells were cultured in vinblastine-containing medium. The mRNA level of P-gp was approximately 7-fold higher in Caco-2 cells cultured with vinblastine (P-gp-induced Caco-2 cells) than in control cells. Western blot analysis showed a significant increase in P-gp expression. After cell differentiation, the mRNA level of P-gp was downregulated, however, P-gp-induced Caco-2 cells still possessed a 5.6-fold higher mRNA level of P-gp compared to control cells. Polarized transport of substrate drugs was greater in the monolayer of P-gp-induced cells than in that of control cells. Moreover, we found that P-gp expression in Caco-2 cells could be further enhanced by applying the higher concentration of vinblastine. Transport activity of P-gp in Caco-2 cells cultured with higher concentration of vinblastine was markedly higher than that in P-gp-induced Caco-2 cells and was comparable with that in MDR1-MDCKII cells. In conclusion, this study provided a stable and highly sensitive in vitro assay system that can identify compounds that are subject to P-gp-mediated efflux. [Abstract/Link to Full Text]

Saitoh H, Kobayashi M, Oda M, Nakasato K, Kobayashi M, Tadano K
Characterization of intestinal absorption and enterohepatic circulation of mycophenolic Acid and its 7-O-glucuronide in rats.
Drug Metab Pharmacokinet. 2006 Oct;21(5):406-13.
To assess the mechanism of gastrointestinal disorders by mycophenolate mofetil (MMF), the intestinal absorption and enterohepatic circulation of mycophenolic acid (MPA), an active metabolite of MMF, and its 7-O-glucuronide (MPAG) were investigated using rat intestinal loops and a linked-rat model. The stability of MPAG in the intestinal fluids, the toxicity of MPA and MPAG to intestinal mucosa, and biliary excretion of MPAG in rats with acute renal failure (ARF) were also characterized. MPA was rapidly and extensively absorbed from the rat intestine whereas MPAG was much less absorbable. When MPA was administered intravenously to bile-donor rats, 1.2% of dose was excreted in bile of receiver rats exclusively as MPAG during 4 h. MPAG was minimally deconjugated in the intestinal fluids. MPAG, but not MPA, significantly enhanced the release of lactate dehydrogenase from intestinal mucosa. When MPA was intravenously administered to ARF rats, the biliary excretion of MPAG significantly increased, compared with that in normal rats. These results demonstrated that MPAG accumulated in the intestinal lumen following biliary excretion and exerted some toxic effect on the intestinal mucosa. It was also suggested that enterohepatic circulation of MPAG under renal dysfunction increased the risk of gastrointestinal disorders due to MPAG. [Abstract/Link to Full Text]

Soyama A, Saito Y, Ohno Y, Komamura K, Kamakura S, Kitakaze M, Tomoike H, Ozawa S, Sawada J
Diverse structures of chimeric CYP-REP7/6-containing CYP2D6 and a novel defective CYP2D6 haplotype harboring single-type *36 and CYP-REP7/6 in Japanese.
Drug Metab Pharmacokinet. 2006 Oct;21(5):395-405.
Chimeric REP7/6 has been used as a marker of CYP2D6 deletion, such as for CYP2D6*5. However, the CYP2D6*10D (*10D) haplotype found in a Japanese population consist of CYP2D6*10B, CYP2D7P-derived 3'-flanking region, and a chimeric repetitive sequence, CYP-REP7/6 (REP7/6) (Ishiguro et al. Clin. Chim. Acta. 2004: 347, 217-221). From our analysis, REP7/6 was found in 26 out of 254 Japanese subjects. Thus, the REP7/6-containing CYP2D6 genes (2D6-REP7/6) were analyzed in detail. In order to specifically detect the 2D6-REP7/6 structure, primers were designed in CYP2D6 intron 6 and the REP7/6 3'-flanking region. Among 26 subjects analyzed by PCR, 5 had 2D6-REP7/6. The other 21 subjects were confirmed to have *5 by another *5-specific primer set. Three out of five subjects with 2D6-REP7/6 had the *10D structure. However, further analysis by PCR and sequencing revealed that their haplotypes were further divided into tandem-type *36-*10D (n=2) and single-type *10D (n=1). The remaining two subjects had a novel type of a *36-containing defective structure that consists of CYP2D6*36 and 3'-flanking REP7/6 (single-type *36-REP7/6). Then, REP7/6 sequences in *5, *10D, *36-*10D, and single-type *36 were determined and classified into 5 types: types A to D for *5, type E for *10D and *36-*10D, and type F for *36. These findings could be useful for accurate determination of *5 and REP7/6-harboring aberrant CYP2D6 haplotypes. [Abstract/Link to Full Text]

Tahara K, Saigusa K, Kagawa Y, Taguchi M, Hashimoto Y
Pharmacokinetics and pharmacodynamics of bisoprolol in rats with bilateral ureter ligation-induced renal failure.
Drug Metab Pharmacokinet. 2006 Oct;21(5):389-94.
The effect of renal failure on the pharmacokinetics and pharmacodynamics of bisoprolol was investigated in bilateral ureter-ligated (BUL) rats. The blood bisoprolol concentrations following 30-min intravenous infusion at a rate of 60 microg/kg/min were higher in renal artery-occluded (RAO) rats than in control rats, and were higher in BUL rats than in RAO rats. Increased blood bisoprolol concentrations accompanied decreased mean systemic clearances: 50.7, 36.4, and 26.2 mL/min/kg in control, RAO, and BUL rats, respectively. The finding indicated that approximately 30% of administered bisoprolol was excreted via the kidney, and that not only the renal clearance but also non-renal clearance of bisoprolol was decreased in BUL rats. The beta-blocking action of bisoprolol was assessed by the reduction in isoproterenol-induced increases in the heart rate. The relationship between blood concentration and the beta-blocking action of bisoprolol in BUL rats was similar to that in control rats. These results suggested that renal excretion and hepatic metabolism of bisoprolol were significantly reduced in BUL rats, but that pharmacodynamics of bisoprolol was not altered by acute renal failure. [Abstract/Link to Full Text]

Takizawa E, Takizawa D, Al-Jahdari WS, Miyazaki M, Nakamura K, Yamamoto K, Horiuchi R, Hiraoka H
Influence of atropine on the dose requirements of propofol in humans.
Drug Metab Pharmacokinet. 2006 Oct;21(5):384-8.
OBJECTIVE: The purpose of this study was to evaluate the effect of atropine on the dose requirement of propofol for induction of anesthesia and propofol concentrations during continuous infusion. METHODS: Study 1: Forty patients were randomly allocated to the control or atropine groups. Induction of anesthesia commenced 3 min following the administration of 0.9% saline or atropine (0.01 mg kg(-1)), using a Diprifuser set to achieve propofol concentration of 6.0 microg mL(-1). The primary end point was the propofol dose per kg at the moment of loss of response to a command. Study 2: Fifteen patients undergoing elective surgery were enrolled. Propofol was administered to all subjects via target-controlled infusion to achieve a propofol concentration at 2.0 microg mL(-1) after intubation. Before and after administration of atropine (0.01 mg kg(-1)), cardiac output (CO) was measured using indocyanine green as an indicator and blood propofol concentration was determined using high-performance liquid chromatography. RESULTS: Study 1: The propofol dose for each group was 2.22+/-0.21 mg kg(-1) for control group and 2.45+/-0.28 mg kg(-1) for atropine, respectively (p=0.014). Study 2: After the administration of atropine, CO was significantly increased from 4.28+/-0.83 to 5.76+/-1.55 l min(-1) (p<0.0001). Propofol concentration was significantly decreased from 2.12+/-0.28 to 1.69+/-0.27 microg mL(-1) (p<0.0001). CONCLUSIONS: Following the administration of atropine, the propofol requirements for the induction of anesthesia were increased and propofol concentrations were decreased during continuous infusion by the administration of atropine. [Abstract/Link to Full Text]

Sugiura T, Kato Y, Kubo Y, Tsuji A
Mutation in an adaptor protein PDZK1 affects transport activity of organic cation transporter OCTNs and oligopeptide transporter PEPT2.
Drug Metab Pharmacokinet. 2006 Oct;21(5):375-83.
Genetic polymorphisms in xenobiotic transporters have recently been clarified to be associated with change in drug distribution and disposition. To expand on recent identification of direct interaction and functional regulation of several transporters by a PDZ (PSD95, Dlg and ZO1) domain containing protein PDZK1, the effect of mutation in PDZK1 on transport activity and subcellular localization of organic cation/carnitine transporters OCTN1 and OCTN2, and oligopeptide transporter PEPT2 was examined in the present study. HEK293 cells stably expressing a mutant transcript PDZK1-E195K (HEK293/PDZK1-E195K) were constructed, followed by transient transfection of cDNA for each transporter. Uptake of tetraethylammonium by OCTN1 was much higher in HEK293/PDZK1 cells, compared with that in the parent HEK293 cells, the uptake in HEK293/PDZK1-E195K cells showing middle range between the two values. Such difference in transport activity was accounted for the difference in transport capacity, with minimal change in affinity of OCTN1 to the substrate or other compounds. The similar difference among HEK293/PDZK1, HEK293/PDZK1-E195K and HEK293 cells was also observed in transport property of OCTN2 and PEPT2, whereas the difference was not so remarkable in each transporter with the last four amino acids deleted, that has much lower interaction potential with PDZK1. Immunohistochemical analysis indicated that OCTN1 was colocalized with PDZK1 on cell-surface, whereas colocalization with PDZK1-E195K was partially observed in cytoplasmic region. These results suggest a novel hypothesis that mutation in PDZK1 potentially changes transport property of various types of xenobiotic transporters by affecting their subcellular localization, possibly leading to change in disposition of various types of substrate drugs. [Abstract/Link to Full Text]

Nishimura M, Naito S
Tissue-specific mRNA expression profiles of human phase I metabolizing enzymes except for cytochrome P450 and phase II metabolizing enzymes.
Drug Metab Pharmacokinet. 2006 Oct;21(5):357-74.
Pairs of forward and reverse primers and TaqMan probes specific to each of 52 human phase I metabolizing enzymes (alcohol dehydrogenase, aldehyde dehydrogenase, aldehyde oxidase, dihydropyrimidine dehydrogenase, epoxide hydrolase, esterase, flavin-containing monooxygenase, monoamine oxidase, prostaglandin endoperoxide synthase, quinone oxidoreductase, and xanthene dehydrogenase) and 48 human phase II metabolizing enzymes (acetyltransferase, acyl-CoA:amino acid N-acyltransferase, UDP-glucuronosyltransferase, glutathione S-transferase, methyltransferase, and sulfotransferase) were prepared. The mRNA expression level of each target enzyme was analyzed in total RNA from single and pooled specimens of various human tissues (adrenal gland, bone marrow, brain, colon, heart, kidney, liver, lung, pancreas, peripheral leukocytes, placenta, prostate, salivary gland, skeletal muscle, small intestine, spinal cord, spleen, stomach, testis, thymus, thyroid gland, trachea, and uterus) by real-time reverse transcription PCR using an ABI PRISM 7700 Sequence Detection System. Further, individual differences in the mRNA expression of representative human phase I and II metabolizing enzymes in the liver were also evaluated. The mRNA expression profiles of the above phase I and phase II metabolizing enzymes in 23 different human tissues were used to identify the tissues exhibiting high transcriptional activity for these enzymes. These results are expected to be valuable in establishing drug metabolism-mediated screening systems for new chemical entities in new drug development and in research concerning the clinical diagnosis of disease. [Abstract/Link to Full Text]

Masubuchi Y
Metabolic and non-metabolic factors determining troglitazone hepatotoxicity: a review.
Drug Metab Pharmacokinet. 2006 Oct;21(5):347-56.
Troglitazone (TGZ), a thiazolidinedione class of antidiabetic agent, causes serious idiosyncratic hepatotoxicity. TGZ is metabolized into reactive metabolites that covalently bind to cellular macromolecules, one of which is oxidation at the chromane ring, a unique structure of TGZ, and another involves oxidative cleavage of the thiazolidinedione ring, a structure common to less hepatotoxic antidiabetics, rosiglitazone and pioglitazone. TGZ is cytotoxic to HepG2 cells and rat and human hepatocytes. However, the role of the reactive metabolite on the TGZ toxicity is controversial, because there was no correlation of the generation of the reactive metabolites with susceptibility to the TGZ cytotoxicity, and chemical inhibitors of drug metabolizing enzymes could not protect the cells against the toxicity. Mitochondrial dysfunction, especially mitochondrial permeability transition, may be a pathophysiological event, which is mediated by TGZ itself and is a major non-metabolic factor. Other events such as apoptosis and PPARgamma-dependent steatosis could be also mediated by TGZ, while inhibition of bile salt export pump, a cause of TGZ-induced cholestasis, may be caused by the TGZ sulfate. In conclusion, although the TGZ is biotransformed into chemically reactive metabolites, there is currently no potential evidence for involvement of the reactive metabolite in the TGZ-induced liver injury. [Abstract/Link to Full Text]

Fukushima-Uesaka H, Saito Y, Maekawa K, Saeki M, Kamatani N, Kajio H, Kuzuya N, Yasuda K, Sawada J
Novel genetic variations and haplotypes of hepatocyte nuclear factor 4alpha (HNF4A) found in Japanese type II diabetic patients.
Drug Metab Pharmacokinet. 2006 Aug;21(4):337-46.
Thirty-nine single nucleotide variations, including 16 novel ones, were found in the 5' promoter region, all of the exons and their surrounding introns of HNF4A in 74 Japanese type II diabetic patients. The following novel variations were identified (based on the amino acid numbering of splicing variant 2): -208G>C in the 5' promoter region; 1154C>T (A385V) and 1193T>C (M398T) in the coding exons; 1580G>A, 1852G>T, 2180C>T, 2190G>A, and 2362_2380delAAGAATGGTGTGGGAGAGG in the 3'-untranslated region, and IVS1+231G>A, IVS2-83C>T, IVS3+50C>T, IVS3-54delC, IVS5+173_176delTTAG, IVS5-181_-180delAT, IVS8-106A>G, and IVS9-151A>C in the introns. The allele frequencies were 0.311 for 2362_2380delAAGAATGGTGTGGGAGAGG, 0.054 for 1580G>A, 0.047 for 1852G>T, 0.020 for IVS1+231G>A, 0.014 for IVS9-151A>C, and 0.007 for the other 11 variations. In addition, one known nonsynonymous single nucleotide polymorphism, 416C>T (T139I), was detected at a 0.007 frequency. Based on the linkage disequilibrium profiles, the region analyzed was divided into three blocks. Haplotype analysis determined/inferred 10, 16, and 12 haplotypes for block 1, 2, and 3, respectively. Our results on HNF4A variations and haplotypes would be useful for pharmacogenetic studies in Japanese. [Abstract/Link to Full Text]

Sasaki T, Goto E, Konno Y, Hiratsuka M, Mizugaki M
Three novel single nucleotide polymorphisms of the human thiopurine S-methyltransferase gene in Japanese individuals.
Drug Metab Pharmacokinet. 2006 Aug;21(4):332-6.
In this study, the entire coding sequence and the exon-intron junctions of the thiopurine S-methyltransferase (TPMT) gene from 200 Japanese individuals were screened for mutation. Three novel single nucleotide polymorphisms (SNPs) were identified-106G>A in exon 3 (Gly36Ser, *20 allele), 967A>G in 3'-untranslated region, and -87C>T in intron 8. The allele frequencies were 0.003 for 106G>A, 0.003 for 967A>G, and 0.010 for IVS8 -87C>T. In addition, the three known SNPs, 474T>C (Ile158Ile), 719A>G (Tyr240Cys, *3C allele), and IVS4 +35C>T were detected at frequencies of 0.299, 0.010, and 0.421, respectively. [Abstract/Link to Full Text]

Tabata K, Katashima M, Kawamura A, Kaibara A, Tanigawara Y
Population pharmacokinetic analysis of micafungin in Japanese patients with fungal infections.
Drug Metab Pharmacokinet. 2006 Aug;21(4):324-31.
The object of this analysis was to develop a population pharmacokinetic model of micafungin, a new anti-fungal agent of the echinocandin class, to optimize dosing in Japanese patients with fungal infections. Population pharmacokinetics parameters were determined using NONMEM based on pharmacokinetic data from 198 subjects in seven clinical studies, comprising four phase I, two phase II and one pediatric phase III study. The healthy subjects received intravenous infusion of 2.5-150 mg micafungin. Adult and pediatric patients, age range of 8 month to 15 yeras old, were received 25-150 mg and 1-6 mg/kg daily, respectively. A total of 1825 micafungin plasma samples were available for this analysis. Two-compartment pharmacokinetic model was adopted. The clearance of micafungin was influenced by body weight in children and platelet counts (PLT). However the PLT accounted for less than 20% of the variation of micafungin clearance in Japanese subjects. In conclusions, body weight is the primary covariate factor in pediatric patients. The dose adjustment by body weight would be required only pediatric patients for the micafungin therapy in Japanese patients with fungal infection. [Abstract/Link to Full Text]

Miyata M, Matsuda Y, Tsuchiya H, Kitada H, Akase T, Shimada M, Nagata K, Gonzalez FJ, Yamazoe Y
Chenodeoxycholic acid-mediated activation of the farnesoid X receptor negatively regulates hydroxysteroid sulfotransferase.
Drug Metab Pharmacokinet. 2006 Aug;21(4):315-23.
Hydroxysteroid sulfotransferase catalyzing bile acid sulfation plays an essential role in protection against lithocholic acid (LCA)-induced liver toxicity. Hepatic levels of Sult2a is up to 8-fold higher in farnesoid X receptor-null mice than in the wild-type mice. Thus, the influence of FXR ligand (chenodeoxycholic acid (CDCA) and LCA) feeding on hepatic Sult2a expression was examined in FXR-null and wild-type mice. Hepatic Sult2a protein content was elevated in FXR-null and wild-type mice fed a LCA (1% and 0.5%) diet. Treatment with 0.5% CDCA diet decreased hepatic Sult2a to 20% of the control in wild-type mice, but increased the content in FXR-null mice. Liver Sult2a1 (St2a4) mRNA levels were reduced to 26% in wild-type mice after feeding of a CDCA diet, while no decrease was observed on Sult2a1 mRNA levels in FXR-null mice after CDCA feeding. A significant inverse relationship (r(2)=0.523) was found between hepatic Sult2a protein content and small heterodimer partner (SHP) mRNA level. PCN-mediated increase in Sult2a protein levels were attenuated by CDCA feeding in wild-type mice, but not in FXR-null mice. Human SULT2A1 protein and mRNA levels were decreased in HepG2 cells treated with the FXR agonists, CDCA or GW4064 in dose-dependent manners, although SHP mRNA levels were increased. These results suggest that SULT2A is negatively regulated through CDCA-mediated FXR activation in mice and humans. [Abstract/Link to Full Text]

Kikuchi A, Nozawa T, Wakasawa T, Maeda T, Tamai I
Transporter-mediated intestinal absorption of fexofenadine in rats.
Drug Metab Pharmacokinet. 2006 Aug;21(4):308-14.
Both influx and efflux transporters are thought to be involved in the intestinal absorption of fexofenadine. The present study examined the influx transporter-mediated intestinal absorption of fexofenadine in rats, focusing on the role of rat oatp3 (Oatp1a5). The intestinal permeability of fexofenadine was evaluated by means of the Ussing chamber method in the presence of a P-glycoprotein inhibitor to block efflux transport. The permeability of fexofenadine from the mucosal to the serosal side was higher than that from the serosal side to the mucosal side. Transport of fexofenadine was saturable, and was significantly decreased by an organic anion transporting polypeptide (oatp) inhibitor. Furthermore, uptake of fexofenadine by Xenopus oocytes expressing rat oatp3 was significantly greater than that by water-injected oocytes, and the affinity of oatp3 for fexofenadine (Km) was about 60 microM, which is comparable with the value obtained by the Ussing chamber method using rat intestinal tissues. These results indicate that oatp3 plays a role as an influx transporter in the intestinal absorption of fexofenadine in rats. [Abstract/Link to Full Text]

Nishimura M, Koeda A, Suzuki E, Kawano Y, Nakayama M, Satoh T, Narimatsu S, Naito S
Regulation of mRNA expression of MDR1, MRP1, MRP2 and MRP3 by prototypical microsomal enzyme inducers in primary cultures of human and rat hepatocytes.
Drug Metab Pharmacokinet. 2006 Aug;21(4):297-307.
The mRNA induction of various transporters by rifampicin (Rif), dexamethasone (Dex) and omeprazole (Ome) was investigated in primary cultures of cryopreserved human and rat hepatocytes. Analysis was performed by quantitative real-time RT-PCR using primers and TaqMan probes. In primary cultures of human hepatocytes, mRNA levels of MDR and MRP1 were increased by about 1.5 fold and 1.3 fold, respectively, by exposure to Rif at 2 to 50 microM as compared with 0.1% DMSO-treated controls. MRP2 mRNA levels in the same human hepatocytes were significantly increased by 1.2 to 1.8 fold by exposure to Rif at 50 microM as compared with controls. In primary cultures of rat hepatocytes, Mdr1a and Mdr1b mRNA levels were not increased or only slightly increased at 24 hr by exposure to any of the inducers at 2, 10 or 50 microM. Mrp2 mRNA levels in the same rat hepatocytes were significantly increased by 7 to 45 fold by exposure to Dex at 2 microM as compared with controls. Based on the species differences observed in the present study, primary cultures of cryopreserved hepatocytes from both the human and rat should be useful in preclinical drug development for evaluating candidate drugs for transporter induction. [Abstract/Link to Full Text]

Aiba T, Horiuchi M, Makita T, Komori Y, Kawasaki H, Kurosaki Y
Peritoneal dialysis alters tolbutamide pharmacokinetics in rats with experimental acute renal failure.
Drug Metab Pharmacokinet. 2006 Aug;21(4):291-6.
The plasma concentration profile of the antidiabetic agent tolbutamide was investigated in glycerol-induced acute renal failure (ARF) rats receiving or not receiving peritoneal dialysis (PD) to assess the impact of performing dialysis on tolbutamide pharmacokinetics. It was revealed that the plasma concentration of tolbutamide was decreased by 23.4% by performing PD in ARF rats, while it was not changed by PD in normal rats. The decrease in the plasma concentration of tolbutamide was nearly proportional to the increase in its volume of distribution. To clarify the mechanisms responsible for the decreased tolbutamide concentration caused by PD, the plasma protein binding of tolbutamide was examined in normal and ARF rats. The plasma unbound fraction of tolbutamide was higher in ARF rats than in normal rats, and the dissociation constants were 3.5+/-0.7 and 5.5+/-0.2 microg in normal and ARF rats, respectively. These results indicated that the unbound fraction of tolbutamide was increased in ARF rats because of its protein binding being suppressed. It is therefore likely that since a measurable amount of tolbutamide can distribute in peritoneal dialysate in ARF rats, but not in normal rats, the plasma concentration of tolbutamide was decreased by performing PD only in ARF rats. These findings suggest that diabetes medication with tolbutamide should be carefully performed in patients receiving dialysis treatment. [Abstract/Link to Full Text]

Tassaneeyakul W, Mahatthanatrakul W, Niwatananun K, Na-Bangchang K, Tawalee A, Krikreangsak N, Cykleng U, Tassaneeyakul W
CYP2C19 genetic polymorphism in Thai, Burmese and Karen populations.
Drug Metab Pharmacokinet. 2006 Aug;21(4):286-90.
The genetic polymorphism of CYP2C19 was examined in three Southeast Asian populations. This study was conducted in 774 Thais, 127 Burmeses and 131 Karens. Genomic DNA was extracted from leucocytes and analyzed by the PCR-RFLP technique. Genotype analysis revealed that the allele frequencies of CYP2C19*1, CYP2C19*2 and CYP2C19*3 in the Thais were 0.68, 0.29 and 0.03, respectively, and those of the Burmese population were 0.66, 0.30 and 0.04, respectively. For Karens, the minority ethnic in Mynmar, the allele frequencies of CYP2C19*1, CYP2C19*2 and CYP2C19*3 were 0.71, 0.28 and 0.01, respectively. The prevalence of PM estimated from genotype data among these three ethnic populations were 9.2%, 11.0%, and 8.4%, respectively. The PM phenotype and the frequencies of CYP2C19 defective alleles, particularly CYP2C19*3 among these three Southeast Asian ethnics appeared to be lower than other Asian populations. Lower prevalence of CYP2C19 PM suggests that these ethnics may have different capacity to metabolize drugs that are substrates of CYP2C19. Certain drug dosage regiments should be considered differently for Asian populations. [Abstract/Link to Full Text]

Aoki K, Kashiwagura Y, Horie T, Sato H, Tateno C, Ozawa N, Yoshizato K
Characterization of humanized liver from chimeric mice using coumarin as a human CYP2A6 and mouse CYP2A5 probe.
Drug Metab Pharmacokinet. 2006 Aug;21(4):277-85.
Coumarin 7-hydroxylation (COH), which is catalyzed almost solely by human CYP2A6 and mouse CYP2A5, shows large differences in activity (humans>mice) and inhibitor specificity between mice and humans. To differentiate human and mouse liver functions of chimeric mice (CM1, CM2 and CM3) prepared with hepatocytes from 3 donors, the microsomal COH activities were measured with and without benzaldehyde and undecanoic gamma-lactone as a specific inhibitor of human CYP2A6 and mice CYP2A5, respectively. The replacement % to human hepatocytes designated as replacement index (RI) was calculated from human specific cytokeratin 8/18 expression in the liver section. The COH activities correlated well with RIs in CM2 (R(2)=0.98) and CM3 (R(2)=0.94), except CM1 whose genotype of donor is CYP2A6*4/*4. However, the COH activities expressed as % of donor activities were not always coincident with RIs, and the inhibition pattern of CM2 and CM3 was human-type after RI exceeded approximately 50%. Subsequently, our attempts to use % of COH activities or inhibition patterns as an accurate functional replacement index were unsuccessful. Since the detection of human CYP2A6 protein in the liver and the steep increase of human albumin (hAlb) levels in the blood were begun from almost RI=50% similarly to the changes of inhibition pattern, RI=50% is the turning point for chimeric mice to have humanized liver function. [Abstract/Link to Full Text]

Shimada T
Xenobiotic-metabolizing enzymes involved in activation and detoxification of carcinogenic polycyclic aromatic hydrocarbons.
Drug Metab Pharmacokinet. 2006 Aug;21(4):257-76.
Polycyclic aromatic hydrocarbons (PAHs) are ubiquitous environmental carcinogens and metabolized by a variety of xenobiotic-metabolizing enzymes such as cytochrome P450 (P450 or CYP), epoxide hydrolase, glutathione transferase, UDP-glucuronosyltransferase, sulfotransferase, NAD(P)H quinone oxidoreductase 1, and aldo-keto reductase. These enzymes mainly participate in the conversion of PAHs to more polar and water-soluble metabolites, and the resultant metabolites are readily excreted from the body. However, during the course of metabolism, a variety of unstable and reactive intermediates of PAHs are formed, and these metabolites attack DNA, causing cell toxicity and transformation. P450s and epoxide hydrolase convert PAHs to proximate carcinogenic metabolites, PAH-diols, and these products are further metabolized by P450s to ultimate carcinogenic metabolites, PAH diol-epoxides, or by aldo-keto reductase to reactive PAH o-quinones. PAHs are also activated by P450 and peroxidases to reactive radical cations that bind covalently to DNA. The oxygenated and reactive metabolites of PAHs are usually converted to more polar and detoxified products by phase II enzymes. Inter-individual differences exist in levels of expression and catalytic activities of a variety of enzymes that activate and/or detoxify PAHs in various organs of humans and these phenomena are thought to be critical in understanding the basis of individual differences in response to PAHs. Factors affecting such variations include induction and inhibition of enzymes by diverse chemicals and, more importantly, genetic polymorphisms of enzymes in humans. [Abstract/Link to Full Text]

Kim SR, Saito Y, Maekawa K, Sugiyama E, Kaniwa N, Ueno H, Okusaka T, Morizane C, Yamamoto N, Ikeda M, Yoshida T, Minami H, Furuse J, Ishii H, Saijo N, Kamatani N, Ozawa S, Sawada J
Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).
Drug Metab Pharmacokinet. 2006 Jun;21(3):248-56.
Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations. [Abstract/Link to Full Text]

Shimizu M, Fujita H, Aoyama T, Yamazaki H
Three novel single nucleotide polymorphisms of the FMO3 gene in a Japanese population.
Drug Metab Pharmacokinet. 2006 Jun;21(3):245-7.
We sequenced all exons and exon-intron junctions of the flavin-containing monooxygenase 3 (FMO3) gene from 2 Japanese individuals and their family members, who were case subjects that showed low FMO3 metabolic capacity among a population of self-reported trimethylaminuria Japanese volunteers. We found two novel single nucleotide polymorphisms (SNPs) (21,254 C>A and 24,006 A>G) causing amino acid substitutions, Thr(201)Lys in exon 5 and Met(260)Val in exon 6, respectively. The Thr(201)Lys and Met(260)Val also presented together with known SNPs (Glu(158)Lys-Glu(308)Gly and Val(257)Met, respectively) in the same alleles of the FMO3 gene to form novel haplotypes. A SNP (30,398 C>T) in the FMO3 gene causing a stop codon at Arg(500) in exon 9 was also discovered. These sequences are as follows: 1) SNP, 060116Shimizu001; GENE NAME, FMO3; ACCESSION NUMBER, AL021026; LENGTH, 25 base; 5'-GTGATATTGCCAC/AAGAACTCAGCCG-3'. 2) SNP, 060116Shimizu002; GENE NAME, FMO3; ACCESSION NUMBER, AL021026; LENGTH, 25 base; 5'-TAC(G/A)TGAAGCAGA/GTGAATGCAAGAT-3'. 3) SNP, 060116Shimizu003; GENE NAME, FMO3; ACCESSION NUMBER, AL021026; LENGTH, 25 base; 5'-CCCATGCAGACAC/TGAGTGGTCGGGA-3'. [Abstract/Link to Full Text]

Ogihara T, Kamiya M, Ozawa M, Fujita T, Yamamoto A, Yamashita S, Ohnishi S, Isomura Y
What kinds of substrates show P-glycoprotein-dependent intestinal absorption? Comparison of verapamil with vinblastine.
Drug Metab Pharmacokinet. 2006 Jun;21(3):238-44.
The influence of P-glycoprotein (P-gp) on intestinal absorption of drugs was investigated by comparison of the uptakes of two P-gp substrates, verapamil and vinblastine, using intestinal segments of wild-type and mdr1a/1b gene-deficient (mdr1a/1b(-/-)) mice, and Caco-2 cells. When [(3)H]vinblastine was injected into intestinal segments of wild-type mice, vinblastine was absorbed from duodenum and ileum, but not from jejunum. This difference among intestinal regions could not be explained by segmental differences of mdr1a mRNA expression. In Caco-2 cells, it was found that vinblastine had a high value of efflux/influx ratio (an index of affinity for P-gp) of 12.1, and a low permeability of less than 1 x 10(-6) cm/sec. The corresponding values for verapamil were 4.9 and 10.6 x 10(-6) cm/sec, respectively. After oral administration of [(3)H]vinblastine to mice, the maximum concentration (C(max)) and the area under the plasma concentration time-curve from time 0 to 24 hr (AUC(0-24 hr)) for mdr1a/1b(-/-) mice were 1.5 times greater than those for wild-type mice, while these parameters were not significantly different between the two strains in the case of [(3)H]verapamil. Therefore, P-gp substrates may be classified into at least two types, i.e., verapamil-type, for which the intestinal absorption is unaffected by P-gp, and vinblastine-type, for which the intestinal absorption is influenced by P-gp. Vinblastine-type P-gp substrates, with low permeability and high affinity for P-gp, would be unfavorable candidates for oral drugs. [Abstract/Link to Full Text]

Nagira M, Tomita M, Mizuno S, Kumata M, Ayabe T, Hayashi M
Ischemia/reperfusion injury in the monolayers of human intestinal epithelial cell line caco-2 and its recovery by antioxidants.
Drug Metab Pharmacokinet. 2006 Jun;21(3):230-7.
We previously established a in vitro system for assessing early ischemia/reperfusion injury using monolayers of human intestinal epithelial cell line Caco-2, in which lipid peroxidation caused by tertiary-butylhydroperoxide (t-BuOOH), a lipid peroxidation inducer, acts as a trigger of the injury. By now, we have shown that superoxide anion participates in the opening of tight junctions (TJ) induced by reoxygenation following the induction of lipid peroxidation by t-BuOOH at a low concentration. The present objectives are to elucidate the dysfunction of P-glycoprotein (P-gp) in addition to the opening of TJ by t-BuOOH at a high concentration condition using rhodamine123 (Rho123) as a P-gp substrate and cyclosporine A (CyA) as a P-gp inhibitor. Also, we compared the inhibition effect of lutein and other compounds such as biliverdin as a radical scavenger on the opening of TJ and the dysfunction of P-gp. t-BuOOH at a high concentration increased the permeability of Rho123 in the apical to basal direction and decreased basal to apical direction when compared with control conditions. t-BuOOH at a high concentration showed no significant difference between directional transport of Rho123 and no inhibition was observed in the permeability of both directions by CyA. The staining intensity of Western blot was decreased by t-BuOOH at a high concentration. Although lutein and the other compounds had recovery effects on the opening of TJ and P-gp dysfunction induced by t-BuOOH, lutein is more advantageous than other compounds since it has effective effects at the lower concentration. In conclusion, the barrier dysfunction such as the inhibition of P-gp in addition to the opening of TJ was induced by t-BuOOH at a high concentration condition. The above two barrier dysfunctions was ameliorated by antioxidant such as lutein and biliverdin. [Abstract/Link to Full Text]

Fetih G, Habib F, Katsumi H, Okada N, Fujita T, Attia M, Yamamoto A
Excellent absorption enhancing characteristics of NO donors for improving the intestinal absorption of poorly absorbable compound compared with conventional absorption enhancers.
Drug Metab Pharmacokinet. 2006 Jun;21(3):222-9.
The characteristics of NO donors, NOC5 [3-(2-hydroxy-1-(1-methylethyl-2-nitrosohydrazino)-1-propanamine), NOC12 [N-ethyl-2-(1-ethyl-2-hydroxy-2-nitrosohydrazino)-ethanamine] and SNAP [S-nitroso-N-acetyl-DL-penicillamine] as absorption enhancers for poorly absorbable drugs were examined in rats using an in situ closed loop method. They were compared with a group of conventional absorption enhancers including sodium glycocholate (NaGC), sodium caprate (NaCap), sodium salicylate (NaSal) and n-dodecyl-beta-D-maltopyranoside (LM). 5(6)-carboxyfluorescein (CF) was used as a model drug to investigate effectiveness, site-dependency, and concentration-dependency of the tested enhancers. Overall, the NO donors can improve the intestinal absorption of CF at low concentration (5 mM), whereas higher concentration was required for the conventional absorption enhancers to elicit the absorption enhancing effect. In the small intestine, SNAP was the most effective absorption enhancers, although its concentration (5 mM) was lower than the conventional absorption enhancers (20 mM). On the other hand, LM and NaCap as well as the three NO donors were effective to improve the colonic absorption of CF. In the regional difference in the absorption enhancing effects, the NO donors showed significant effects in all intestinal regions, whereas we observed a regional difference in the absorption enhancing effect of the other conventional absorption enhancers. In the conventional enhancers, the absorption enhancing effects were generally greater in the large intestine than those in the small intestine. LM and NaCap were ineffective in the jejunum, although they were effective for improving the absorption of CF in the colon. NaSal was ineffective in both the jejunum and the colon. The absorption enhancement produced by NO donors was greatly affected by increasing the enhancer concentration from 3 to 5 mM, but only a slight increase was obtained when the concentration was raised to 10 mM. Similar results were obtained for the other enhancers over the range of 10 to 20 mM, but the absorption enhancing effects of these enhancers were almost saturated above these concentrations. These results suggest that NO donors possess excellent effectiveness as absorption enhancers for poorly absorbable drugs compared with the conventional enhancers. They can enhance intestinal absorption of CF from all intestinal regions and they are effective at very low concentrations. [Abstract/Link to Full Text]

Eto N, Tomita M, Hayashi M
NaPi-mediated transcellular permeation is the dominant route in intestinal inorganic phosphate absorption in rats.
Drug Metab Pharmacokinet. 2006 Jun;21(3):217-21.
Inorganic phosphate in food is absorbed two ways, the transcellular route via the brush border membrane and the paracellular route via tight junctions. NaPi, a sodium-dependent inorganic phosphate transporter, is expressed in rat and human intestine. However, the relative contribution of NaPi to total carrier-mediated transport of physiological concentrations of inorganic phosphate in rat intestine is not clear. Here, we characterized inorganic phosphate transport across the rat small intestine using a voltage-clamp analysis which allowed the diffrentiation of inorganic phosphate permeation through these two (transcellular and paracellular) routes. Results showed that, under a physiologically normal transmucosal electrical potential difference (about 2 mV), permeation of inorganic phosphate by the transcellular route was greater than that by the paracellular route. Further, transport was significantly decreased by the addition to the incubation medium of phosphonoformic acid, a sodium-dependent phosphate transporter inhibitor, and severely inhibited under sodium-free conditions. Similar results were obtained without the voltage-clamp. Together, these results suggest that NaPi-mediated transcellular permeation is the dominant route in the absorption of inorganic phosphate across the small intestine. [Abstract/Link to Full Text]

Soyama A, Saito Y, Kubo T, Miyajima A, Ohno Y, Komamura K, Ueno K, Kamakura S, Kitakaze M, Tomoike H, Ozawa S, Sawada J
Sequence-based analysis of the CYP2D6*36-CYP2D6*10 tandem-type arrangement, a major CYP2D6*10 haplotype in the Japanese population.
Drug Metab Pharmacokinet. 2006 Jun;21(3):208-16.
The frequency of the CYP2D6*10 allele (100C>T) in the Japanese is relatively high (0.3-0.4), and the two *10-related genes, Ch1 (currently *10B) and Ch2 (*36), and their tandem arrangement Ch(2)-Ch(1) (*36-*10B) have been reported. Although the tandem form of *36-*10 is assumed to be a major form, no detailed information has been reported for its intervening and flanking regions. Thus in this study, the tandem-type *36-*10B and the single-type *10 were analyzed by long-range PCR and sequencing of the subsequent nested PCR products. The sequence of the entire *36-*10 region confirmed the recombination of CYP2D6*10 with CYP2D7P. Also, we found that most of the *10B-harboring haplotypes have the upstream *36 gene and that the majority of the remaining haplotypes are the single-type *10B. Haplotype frequencies of the single-type *10 and *36-*10B were 0.06 and 0.30, respectively, in the subjects analyzed. Additionally, several novel single nucleotide polymorphisms (SNPs) were found in the *36 region and several *36 haplotypes were identified. This sequence information is an important addition to the CYP2D6 sequence data that was obtained by the human genome project. [Abstract/Link to Full Text]

Saito M, Okutomi T, Shimizu M, Matsumoto Y, Yamazaki H, Hoka S
Activities of rat cytochrome P450 3A and 2C isoforms are increased in vivo by magnesium sulfate as evidenced by enhanced oxidation of bupivacaine and testosterone in liver microsomes.
Drug Metab Pharmacokinet. 2006 Jun;21(3):201-7.
We previously reported that magnesium sulfate (MgSO(4)) increases the threshold dose of bupivacaine in inducing seizure in rats. Cytochrome P450 (P450) isoforms involved in the biotransformation of bupivacaine to three oxidative metabolites and the effects of MgSO(4) in vivo on the P450 activities in rats were investigated. Of six cDNA-expressed rat P450 isoforms tested, CYP3A2 and CYP2C11 had high rates for N-debutlylation and 3'-hydroxylation of bupivacaine, respectively. The liver microsomes prepared from male rats pretreated with intravenous administration of MgSO(4) (a bolus dose of 25 mg/kg, followed by infusion of 2.0 mg/kg/min for 6 h) showed increased V(max) values for N-debutylation and 3'-hydroxylaiton of bupivacaine compared to the liver microsomes from control rats. Administration of MgSO(4) also increased the activities of testosterone 6beta- and 16alpha-hydroxylation. Although the level of expression of CYP3A and CYP2C isoforms in the liver microsomes were unchanged, NADPH-P450 reductase and cytochrome b(5) were found to be induced by intravenous administration of MgSO(4). These results suggest that CYP3A and CYP2C isoforms are activated by MgSO(4) in vivo as a consequence of enhanced microsomal electron transfer due to induction of NADPH-P450 reductase and cytochrome b(5), leading to the increased metabolism and clearance of bupivacaine. [Abstract/Link to Full Text]

Markova S, Nakamura T, Sakaeda T, Makimoto H, Uchiyama H, Okamura N, Okumura K
Genotype-dependent down-regulation of gene expression and function of MDR1 in human peripheral blood mononuclear cells under acute inflammation.
Drug Metab Pharmacokinet. 2006 Jun;21(3):194-200.
Recent advances in pharmacogenomics have suggested the association of clinical outcome of glucocorticoid-based anti-inflammatory therapy with a single nucleotide polymorphism at position 3435 in exon 26 (C3435T) of the MDR1 gene. In the present study, the effects of the MDR1 C3435T genotype on the time-dependent profiles of gene expression and function of MDR1/P-glycoprotein were evaluated in peripheral blood mononuclear cells (PBMCs) under lipopolysaccharide (LPS)-induced experimental acute inflammation. LPS treatment resulted in the rapid elevation of IL-1beta and TNF-alpha mRNA levels relative to beta-actin mRNA at 1 h, with a subsequent slight decrease at 3 h after the treatment, while the down-regulation of the relative concentration of MDR1 mRNA was found at 3 h, not at 1 h, after LPS treatment. Here, the C3435T genotype-dependent down-regulations of MDR1 mRNA level were found for CC(3435) and CT(3435), but not for TT(3435), and were 64.1+/-10.1%, 71.4+/-5.9% and 100.0+/-22.5% (+/-S.D.), respectively, of their respective baseline levels, which were independent of C3435T (0.010+/-0.005, 0.011+/-0.013 and 0.009+/-0.006 (+/-S.D.), respectively). The C3435T genotype-dependent down-regulation was supported by the increase of the intracellular accumulation of calcein in PBMCs treated with LPS for 72 h, and the increase was more predominant for CC(3435) than TT(3435). These data suggested that glucocorticoid-based anti-inflammatory therapy might be more effective for C(3435)-allele carriers than non-carriers. [Abstract/Link to Full Text]

Nagai J, Taogoshi T, Tokunaga A, Nishikawa H, Murakami T, Takano M
Characterization of prostaglandin E1 transport in rat renal brush-border membrane.
Drug Metab Pharmacokinet. 2006 Jun;21(3):186-93.
Transport of prostaglandin E(1) (PGE(1)) was investigated in rat renal brush-border membrane vesicles. The uptake of [(3)H]PGE(1) was sensitive to osmosis and temperature. This uptake was saturable and mediated by high-affinity (K(m)=2.1 microM)/low-capacity (V(max)=17.4 pmol/mg protein/30 sec) and low-affinity (K(m)=526.5 microM)/high-capacity (V(max)=1,032.5 pmol/mg protein/30 sec) transport systems. [(3)H]PGE(1) uptake was Na(+)-independent and inhibited by various eicosanoids i